Skip to main content

A decline in transcript abundance for Heterodera glycines homologs of Caenorhabditis elegans uncoordinatedgenes accompanies its sedentary parasitic phase

Abstract

Background

Heterodera glycines (soybean cyst nematode [SCN]), the major pathogen of Glycine max (soybean), undergoes muscle degradation (sarcopenia) as it becomes sedentary inside the root. Many genes encoding muscular and neuromuscular components belong to the uncoordinated (unc) family of genes originally identified in Caenorhabditis elegans. Previously, we reported a substantial decrease in transcript abundance for Hg-unc-87, the H. glycines homolog of unc-87 (calponin) during the adult sedentary phase of SCN. These observations implied that changes in the expression of specific muscle genes occurred during sarcopenia.

Results

We developed a bioinformatics database that compares expressed sequence tag (est) and genomic data of C . e legans and H . g lycines (CeHg database). We identify H. glycines homologs of C. elegans unc genes whose protein products are involved in muscle composition and regulation. RT-PCR reveals the transcript abundance of H. glycines unc homologs at mobile and sedentary stages of its lifecycle. A prominent reduction in transcript abundance occurs in samples from sedentary nematodes for homologs of actin, unc-60B (cofilin), unc-89, unc-15 (paromyosin), unc-27 (troponin I), unc-54 (myosin), and the potassium channel unc-110 (twk-18). Less reduction is observed for the focal adhesion complex gene Hg-unc-97.

Conclusion

The CeHg bioinformatics database is shown to be useful in identifying homologs of genes whose protein products perform roles in specific aspects of H. glycines muscle biology. Our bioinformatics comparison of C. elegans and H. glycines genomic data and our Hg-unc-87 expression experiments demonstrate that the transcript abundance of specific H. glycines homologs of muscle gene decreases as the nematode becomes sedentary inside the root during its parasitic feeding stages.

Background

Many aspects of muscle development and maintenance were elucidated through genetic screens in the free-living nematode C. elegans [1–3]. Subsequently, homologs of these genes can be found in other organisms using bioinformatics, allowing a broader understanding of how they may function. Most of the studies investigating muscle development and maintenance in C. elegans focus on the location of the proteins or examine their genetic and biochemical nature. There is less work on determining what happens to these muscle proteins (and hence changes in muscle composition) over the course of normal development [4, 5].

The formation, maintenance and degradation (wasting) of muscles involve a suite of proteins, many that are highly conserved [6–12]. The wasting of muscles over time is known as sarcopenia [13]. Sarcopenia is attributed to many factors including aging, hormone balance, decreased physical activity, malnutrition and oxidative stress [14, 15]. In C. elegans, contraction-related injury of pharynx muscles causes sarcopenia [15]. Sarcopenia normally occurs slowly over the lifetime of an organism. However, several genetic diseases such as Duchenne muscular dystrophy (DMD) generate similar, but hastened, wasting phenotypes [16]. In these cases, however, muscles can never regenerate due to their genetic predisposition. While genetic disorders may mimic sarcopenia, some organisms undergo rapid muscle wasting that is normal to specific stages of their lifecycle. Some reports indicate that this targeted degradation of muscle proteins is actually adaptive and not pathological. Thus, sarcopenia provides resources that can be utilized for other metabolic functions. [17]. The decrease in muscle protein content, presumably, would be accompanied by a decrease in transcription of those genes.

Our lab has focused on the interaction between the parasitic nematode Heterodera glycines and Glycine max [18–26]. H. glycines is the major parasite of G. max and is responsible for causing losses approaching a billion dollars annually for the agricultural industry in the U.S. [27]. Thus, knowledge on the regulation of muscle development is not only relevant to muscle senescence, probable nutrient recycling, for better understanding its developmental biology and for understanding parasitism, but may, in turn, lead to better nematode control measures. The C . e legans- H . g lycines database (CeHg database) allows us to assign function and better understand H. glycines genes [26]. The CeHg database connects the vast information on C. elegans gene function with H. glycines expressed sequence tags (ests) to rapidly identify essential H. glycines genes that could be attributed to a specific defect (i.e. lethality [26]). In fact, one H. glycines gene predicted to be essential using this bioinformatics approach, was shown to be essential through gene silencing using RNAi [26]. RNAi decreased the transcript abundance of the targeted gene, causing nematode death. [26]. We believe that the CeHg database can identify genes important to muscle biology and sarcopenia in H. glycines during its lifecycle.

The genetically-defined unc oordinated (unc) genes perform many functions in C. elegans. The protein products of the unc genes are involved in muscle focal adhesion, architecture and stimulation (via neuromuscular connections). However, null alleles of unc genes can exhibit Paralyzed Arrested at Two-fold stage (pat) phenotypes. The unc mutants all display uncoordinated motion, slow movement, or paralysis [3]. The unc family of mutants contains 114 different members [3, 28]. We believe that much of the muscle degeneration observed in H. glycines would likely involve transcriptional regulation of H. glycines homologs of unc genes whose protein products are involved in (1) the acto-myosin complex, (2) muscle focal adhesion or (3) other aspects of muscle composition and regulation.

In this paper, we use an in-house bioinformatics database [26] to identify H. glycines homologs of unc genes. We identify H. glycines homologs of genes composing (1) acto-myosin complex, (2) muscle focal adhesion and (3) other aspects of muscle composition and regulation. We determine the transcript abundance of these H. glycines unc homologs using RT-PCR. Gene expression for many of these Hg-unc homologs is high during the mobile phase of H. glycines development and is lower during the sedentary phase of H. glycines life cycle.

Results

Identification of unc genes in H. glycines

Unc gene products compose various parts of the body wall muscle (Fig. 1). We identified 45 H. glycines est homologs of C. elegans unc genes (Hg-unc) (Figs. 2 and 3). We confirmed the identification of the Hg-unc genes by performing manual blast searches of the C. elegans unc genes in Genbank. We also identified other H. glycines ests (dystrophin [Hg-dys-1], neprilysin [Hg-nep-1], actin [Hg-act-1], talin [Hg-talin], pat-6 [Hg-pat-6]) whose mutants exhibit unc phenotypes or whose protein products interact with UNC proteins in C. elegans. However, the original unc mutant screens did not identify them (Figs. 2 and 3).

Figure 1
figure 1

A Diagrammatic representation of a muscle cross-section shows the dense body (DB) and M-line (M). This section is divided into four regions; A, muscle; B, basal lamina; C, hypodermis; D, cuticle. The M-line is composed of unc-89. Arrows point toward the position of actin and myosin. The unc genes studied and their relative positions are provided to the right. Genes in red are part of this study. Genes in black were not studied. Figure adapted from [6, 73, 74].

Figure 2
figure 2

H. glycines est homologs of C. elegans unc genes. Column headings provide the unc gene, H. glycines est sequence, e-value, and gene function. The genes are divided into six groups (Group I-VI) based on the following arbitrarily selected significance intervals: E-values between 0 and 1E-100 (Group I), between 1E-100 and 1E-80 (Group II), between 1E-80 and 1E-60 (Group III), between 1E-60 and 1E-40 (Group IV), between 1E-40 and 1E-20 (Group V) and E-values > 1E-20 (Group VI) [26]. In yellow are the genes used for RT-PCR experiments.

Figure 3
figure 3

H. glycines est homologs of C. elegans unc genes. Column headings provide the unc gene, H. glycines est sequence, e-value, and gene function. The genes are divided into six groups (Group I-VI) based on the following arbitrarily selected significance intervals: E-values between 0 and 1E-100 (Group I), between 1E-100 and 1E-80 (Group II), between 1E-80 and 1E-60 (Group III), between 1E-60 and 1E-40 (Group IV), between 1E-40 and 1E-20 (Group V) and E-values > 1E-20 (Group VI) [26]. In yellow are the genes used for RT-PCR experiments. The previously published H. glycines muscle gene, Hg-unc-87 [19] is presented in cyan.

Transcript abundance of uncgenes involved in thin filament composition and maintenance

We identified a decline in transcript abundance for Hg-unc-87 during the transition from the mobile to the sedentary phase of the H. glycines lifecycle [19]. This observation indicates that microfilament degradation occurs during muscle wasting. Bioinformatics analyses identified several H. glycines ests that are homologous to C. elegans thin filament genes, including Hg-act-1, Hg-unc-27, Hg-unc-60A, Hg-unc-60B and Hg-unc-78 (Figs. 2 and 3). RT-PCR revealed a substantial decline in actin transcript abundance occurring between the J2 stage and 15 dpi nematodes (Fig. 4). RT-PCR revealed a substantial decline in transcript abundance of Hg-unc-27 occurring between the J2 stage and 15 dpi nematodes (Fig. 4). We examined the expression profile of the two Hg-unc-60 isoforms (A and B) and Hg-unc-78. Hg-unc-60A is the non-muscle unc-60 isoform, while Hg-unc-60B is the muscle-specific isoform) RT-PCR of Hg-unc-60A reveals little change in transcript abundance occurring throughout the H. glycines lifecycle (Fig. 4). However, RT-PCR reveals a substantial decline in transcript abundance occurring for Hg-unc-60B between the J2 stage and 15 dpi nematodes (Fig. 4). The decline in transcript abundance for Hg-unc-60B and not Hg-unc-60A, occurring between the J2 stage and 15 dpi nematodes, is in agreement with its muscle-specific activity. RT-PCR reveals little change in transcript abundance occurring throughout the H. glycines lifecycle for Hg-unc-78 (Fig. 4).

Figure 4
figure 4

RT-PCR fold expression for H. glycines actin and actin-interacting unc genes. RT-PCR of Hg-act-1, Hg-unc-27, Hg-unc-60A/B, and Hg-unc-78 ESTs homologous to C. elegans unc genes showing the fold expression (y-axis) plotted against the time-point (egg, J2, 15 dpi and 30 dpi).

Transcript abundance of uncgenes involved in thick filament composition and maintenance

Bioinformatics analyses identified H. glycines ests homologous to C. elegans thick filament genes (Figs. 2 and 3). Transcript abundance of H. glycines unc genes whose homologous gene products compose thick filaments in C. elegans was measured using RT-PCR. RT-PCR revealed a substantial decline in transcript abundance of Hg-unc-15 and Hg-unc-54 occurring between the J2 stage and 15 dpi nematodes (Fig. 5). Furthermore, transcript levels of Hg-unc-89 also decline between the J2 stage and 15 dpi nematodes (Fig. 5).

Figure 5
figure 5

RT-PCR fold expression for H. glycines myosin and myosin interacting unc genes. RT-PCR of Hg-unc-15 (paramyosin), Hg-unc-27, Hg-unc-54 (myosin) and Hg-unc-89 C. elegans unc genes showing the fold expression (y-axis) plotted against the time-point (egg, J2, 15 dpi and 30 dpi).

Transcript abundance of focal adhesion complex genes

Bioinformatics analyses also identified H. glycines ests homologous to C. elegans focal adhesion genes (Figs. 2 and 3). Hg-unc-97 transcript levels decrease in abundance between the J2 and 15 dpi nematodes, as shown by RT-PCR (Fig. 6). We explored the focal adhesion complex further by examining the transcript abundance of Hg-unc-112, Hg-pat-6 and Hg-talin. Hg-unc-112, Hg-pat-6 and Hg-talin transcript levels decrease between the J2 stage and 15 dpi nematodes (Fig. 6). Bioinformatics analyses did not identify homologs of other focal adhesion complex proteins.

Figure 6
figure 6

RT-PCR fold expression for H. glycines muscle focal adhesion complex genes. Results of transcript levels of Hg-unc-97, Hg-unc-112, Hg-pat-6 and Hg-talin showing the fold expression (y-axis) plotted against the time-point (egg, J2, 15 dpi and 30 dpi).

RT-PCR of H. glycines ests homologous to C. elegans uncgenes

Bioinformatics analyses identified H. glycines ests homologous to C. elegans genes whose protein products function in other aspects of muscle biology (Figs. 2 and 3) These H. glycines unc genes include Hg-unc-9, Hg-unc-22 (twitchin), Hg-unc-31(CAPS), Hg-unc-52 (perlecan), Hg-unc-101, Hg-unc-115, Hg-unc-110 (Hg-twk-18), Hg-dys-1, and Hg-nep-1. RT-PCR analysis indicated that modest changes in transcript abundance occur for Hg-unc-9, Hg-unc-22, Hg-unc-31, Hg-unc-52, Hg-unc-101, Hg-unc-115, Hg-dys-1, and Hg-nep-1 between the J2 stage and 15 dpi nematodes (Fig. 7). RT-PCR also indicated that Hg-unc-110 transcript abundance decreases substantially between the J2 stage and 15 dpi nematodes (Fig. 7).

Figure 7
figure 7

RT-PCR fold expression for the other H. glycines unc genes. RT-PCR of Hg-unc-9, Hg-unc-22, Hg-unc-31, Hg-unc-52, Hg-unc-101, Hg-unc-115, Hg-unc-110, Hg-dys-1 and Hg-nep-1 showing the fold expression (y-axis) plotted against the time-point (egg, J2, 15 dpi and 30 dpi).

Discussion

Use of the CeHg database to identify unc genes in H. glycines

Body wall muscle degradation accompanies the sedentary phase of H. glycines as it feeds from the syncytium. Thus, important transcriptional, translational, and post-translational changes occur at this time. We began our analysis of H. glycines muscle wasting by identifying H. glycines homologs of C. elegans muscle genes. We then identified the transcript abundance of those genes whose protein products compose the acto-myosin complex, muscle focal adhesion complex, neuromuscular connections and potassium channels.

The acto-myosin complex is composed of interdigitating thin and thick filaments that are bundled by UNC-87 [29–31]. Previously, we observed a decline in transcript abundance of Hg-unc-87 [19]. This demonstrated that depletion of components of the acto-myosin complex may occur during the sedentary phase of the H. glycines lifecycle. Actin and troponin I (unc-27) are primary components of the thin filaments. Actin is not classified as an unc gene. However, the unc-92 mutant of C. elegans maps to the actin locus and may actually be actin. Recently, Willis et al. [11], found that the actin family in C. elegans is composed of five highly conserved isoforms (act-1–5) and yields an unc phenotype [11]. Only one actin gene is present in H. glycines [32]. Unc-27 is involved in thin filament maintenance. UNC-27 forms a complex with troponin C (PAT-10) and troponin T [33–35] to accomplish calcium-dependent regulation of the acto-myosin interaction [36]. Mutant unc-27 disorganizes dense body positioning. Mutant unc-27 causes less well-defined sarcomeres with small regions of thin filaments interspersing within the overlap of A-bands [37]. We found that, as expected, Hg-act-1 and Hg-unc-27 experience a substantial decrease in expression between J2 and 15 dpi nematodes

The dynamic nature of actin filaments is under control of the actin interacting proteins UNC-60 and UNC-78. UNC-60 is the actin depolymerizing factor (ADF) cofilin. Mutations in unc-60 cause disorganization in muscles by preventing bundling of thin filaments with myosin into functional contractile units [38]. However, in C. elegans the unc-60 gene actually encodes two completely different protein products. UNC-60A and UNC-60B are products of SUP-12-dependent alternative splicing [39]. UNC-60A and UNC-60B perform distinct roles in actin dynamics [40]. UNC-60A is the non-muscle cofilin isoform while the UNC-60B is the muscle-specific cofilin. Like C. elegans [41], H. glycines has orthologous mRNA sequences for both unc-60A and unc-60B. UNC-78 is the muscle-specific actin interacting protein (AIP). UNC-78 works in concert with UNC-60B to depolymerize microfilaments into actin monomers [40–43]. Unlike unc-60, unc-78 does not appear to have multiple splice variants that perform distinct muscle and non-muscle functions. Our examination of unc-60, indicates that the muscle-specific unc-60 isoform, Hg-unc-60B, exhibits a substantial decrease in transcript abundance between J2 and 15 dpi nematodes. This is consistent with its important role in muscle organization. As expected, the non-muscle unc-60 isoform, Hg-unc-60A, does not exhibit changes in transcript abundance during the H. glycines lifecycle. Hg-unc-78, a gene whose protein product regulates actin polymerization does not experience a substantial change in gene expression during the transition from the J2 stage to the sedentary phase. These observations, taken together with the substantial decrease in transcript abundance of the actin bundling muscle gene Hg-unc-87 [19], indicate that major changes in transcript abundance occur for Hg-act-1, Hg-unc-27 and the protein products (i.e. Hg-UNC-60B) that regulate actin in the body wall muscles.

Myosin metabolism and muscle mass

Thick filaments are major components of muscles. In C. elegans, myosin (UNC-54), paromyosin (UNC-15) and myosin heavy chain A (MYO3) compose thick filaments. Thick filaments are anchored to the M-line on one side and bound to the dense body on the side by the protein titin [44]. UNC-89 organizes muscles by assembling thick filaments into A-bands [45]. UNC-89 is also essential for M-line assembly [45]. There are three UNC-89 isoforms n C. elegans [45]. Our RT-PCR analysis demonstrates a decrease in transcript abundance for Hg-unc-15, Hg-unc-54 and Hg-unc-89 occurring during muscle wasting. Thus, a decrease in transcript abundance for actin and myosin gene products occurs during muscle wasting as nematodes are becoming sedentary during their parasitic feeding stages. Loss of muscle mass occurs in mutants for muscle genes. For example, loss of muscle mass is a characteristic of DMD, caused by dys-1 mutants. However, in C. elegans, DMD-like muscle defects also require dystrobrevin (DYB-1). A microarray experiment explored the complexities of the dys-1 mutant background [46]. Microarrays of dys-1 revealed 44 total probe sets are induced while 71, including unc-89, are suppressed [46]. It is not clear how a decrease in transcript abundance of unc-89 is involved in DMD. Differential expression of myosin transcripts was also observed in that study [46].

Muscle focal adhesion complex degradation and muscle mass

The focal adhesion complex is composed of numerous proteins. In C. elegans, UNC-97 is part of the PINCH family of proteins that are composed of five lin-11 isl-1 mec-3 [47] (LIM) domains. LIM domains are found in proteins with wide-ranging cellular roles including fate determination of cells, cytoskeleton, organ development and intracellular trafficking. LIM domains have a consensus amino acid sequence CX2CX16–23HX2CX2CX2CX16–23CX2–3(C, H, D) and are putative structural motifs for binding zinc [47, 48]. The tandem nature of the LIM domains provides potential for multiple protein-protein interactions. The LIM domain-containing protein family is characterized by its ability to attach to body wall muscles, vulval muscles, and mechanosensory neurons [49, 50]. C. elegans UNC-97 does this by positioning itself with the β-integrin PAT-3 of muscles [50]. A splice-site mutation of unc-97 displays an unc phenotype, while the phenotype displayed by RNAi is pat and is embryonic lethal. Thus, UNC-97 is necessary for assembly and stability of muscular adherens junctions [50]. In C. elegans, the structural components that secure myofibers to the extracellular matrix, such as integrin, vinculin, talin, and α-actinin are conserved. This complex is similar in organization to adherens junctions in tissue culture cells [50]. The depletion of UNC-97 function leads to the disruption of these focal adhesion structures as well as of the mechanosensory neurons [50]. Further biochemical studies show the integrin-linked kinase (PAT-4) binds UNC-97. PAT-4 binds at the first Zn+2-binding module of the first LIM domain through an interaction with the N-terminal-most region of ankyrin repeat 1 (ANK1). In C. elegans, a biochemical interaction occurs between the sex-linked UNC-98 and UNC-97 [51]. This interaction requires the first two LIM domains of UNC-97 and all four Zn+2-fingers of UNC-98 [51]. The biological role for LIM domain 4, the most highly conserved LIM domain of UNC-97, remains elusive. Other proteins composing focal adhesion complex are UNC-112, a novel protein required for integrin localization [52]; PAT-6, responsible for assembling integrin adhesion complexes [53] and TALIN, a protein requiring β-integrin for its incorporation into focal adhesion-like structures [54].

Our bioinformatics analysis identified the focal adhesion complex genes Hg-unc-97, Hg-unc-112, Hg-talin, and Hg-pat-6. A modest decrease in transcript abundance occurs for these genes between the J2 and 15 dpi nematodes. These results demonstrate that the deterioration of focal adhesion sites, by depletion of Hg-UNC-97, Hg-UNC-112, Hg-TALIN, and Hg-PAT-6, may not be a major contributor to body wall muscle wasting.

Uncmetabolism and muscle mass

Unc gene products perform other important roles in muscle biology. For example, UNC-9, is a neuromuscular gap junction protein [55]; UNC-22 (twitchin) is involved in muscle A-band structure [56, 57]; UNC-31(CAPS) is involved in the neuromuscular junction and neurosecretion [58], UNC-52 (perlecan), is a muscle basement membrane heparan sulfate proteoglycan protein [59]. Mutant unc-52 can also exhibit a pat phenotype, depending on the mutant allele [60]; UNC-101, is a clathrin-associated protein having intense expression in muscles and pharynx; UNC-115, is an actin-binding, LIM domain containing protein that is involved in neuronal axon guidance [61, 62] and UNC-110, is a potassium channel subunit protein involved in body wall muscle control [63]. Dystrophin (dys-1) and neprilysin (nep-1) are other genes whose mutants exhibit unc-like phenotypes. The dys-1 gene is the C. elegans Duchenne muscular dystrophy homolog. The dys-1 gene product is part of the dystrophin-glycoprotein complex that is found in the plasma membranes of muscle cells. The dystrophin-glycoprotein complex is responsible for linking the intracellular cytoskeleton to the extracellular matrix and thought to be important for organizing signal molecules [64] and mechanical integrity [65]. The nep-1 gene product is involved in the neuronal network of pharyngeal pumping [66].

We observed only modest changes in gene expression occurring for many of the other H. glycines unc gene homologs. However, the H. glycines homolog of the body wall muscle-specific potassium channel protein, UNC-110, experiences a substantial decrease in transcript abundance between the J2 and 15 dpi nematodes. This decrease in transcript abundance is similar to the decrease in transcript abundance shown for the acto-myosin genes. It is not clear how a decrease in abundance for potassium channel proteins like Hg-UNC-110 would contribute to the sedentary nature of H. glycines during later stages of parasitism. However, potassium channels do perform major roles in muscle function in C. elegans [63, 67, 68]. At least 42 genes exist in the C. elegans genome that encode two-P domain K(+) (TWK) channels. These K+ channel subunits contain four transmembrane domains and two pore regions. Unc-110 is twk-18 and in C. elegans, TWK-18 localizes to the body wall muscle. The twk-18 mutant confers both uncoordinated movement and paralysis, probably a consequence of their expression of much larger potassium currents [63]. The locomotion defect caused by mutants in K+ channel genes [63, 67, 68] indicates how the substantial decrease in Hg-unc-110 transcript abundance could contribute to the lack of mobility in H. glycines during its sedentary phase.

Conclusion

Our results demonstrate a decrease in transcript abundance for a specific subset of H. glycines homologs of unc genes. This decrease in transcript abundance correlates to the sedentary phase of the H. glycines lifecycle. We show a substantial decrease in transcript abundance of genes composing the acto-myosin complex and also for the K+ channel homolog Hg-unc-110 during muscle wasting. Deterioration of focal adhesion sites does not appear to account for much of the muscle mass lost during sarcopenia in H. glycines.

Methods

Plant and nematode materials and RNA isolation

Plant and nematode materials were grown at the United States Department of Agriculture Soybean Genomics and Improvement Laboratory as described previously [21] according to the moisture replacement system [69]. Our study uses eggs and J2 stage nematodes that are composed of male and female nematodes. This was done because at this time it is not possible to distinguish between immature male and females at the egg and J2 stages. Hatching and subsequent migration of J2s are identical between male and female nematodes. Thus, it is likely that, concerning muscle biology, males and females are nearly identical at the egg and J2 stages. The later stages we use (15 and 30 dpi) are composed entirely of sedentary parasitic female nematodes because that was the focus of this study.

Briefly, G. max cv. Peking seeds were grown in a sand mix in standard greenhouse conditions. To promote hatching, eggs from the H. glycines isolate TN8 (susceptible reaction) were incubated in sterile water at room temperature on a rotary shaker at 25 rpm. After two days on the rotary shaker, the J2s were collected and concentrated by centrifugation to approximately 5,200 J2/ml. Replicate experiments were performed and completed by running one experiment to completion and then collecting data. A second experiment was then run at approximately one month later after the first experiment was completed. Thus, we isolated different isolations of H. glycines eggs, J2, 15 dpi and 30 dpi nematodes for each experiment. Four plants contained in a beaker were inoculated with 5,200 J2 nematodes. For RT-PCR experiments, recovery of the 15 and 30 dpi H. glycines samples from G. max roots was performed according to [69] and also done previously in our lab [19]. Briefly, H. glycines-infected G. max roots grown for either 15 or 30 dpi were dipped into water to remove sand. At 15 and 30 dpi, female H. glycines are partially emerged from the root, facilitating collection of pure nematode samples. Roots were lightly massaged to liberate female H. glycines into a sieve of 150 μm pore size (VWR Scientific; Bridgeport, NJ). This filtration step would remove any additional male nematodes that were remaining in the root. To obtain egg and J2 samples, mature females were harvested at 30 dpi and crushed. The eggs were sifted through a 250 μm sieve and captured onto a 25 μm sieve. The eggs were hatched for two days in distilled water on a rotary shaker at 25 rpm. Pure J2 suspensions are made by sifting them through a 41 μm nylon mesh and collected with a low-speed centrifugation. The RT-PCR samples (J2, 15 dpi female, 30 dpi female or eggs) were flash-frozen in liquid nitrogen and ground to a fine powder using mortar and pestle chilled in liquid nitrogen. Total RNA extraction was performed using the method of Mujer et al. [70].

CeHg database analysis

The CeHg bioinformatics database [26] is a database containing 300,773 ests and 6,630 genomic sequences from C. elegans and 24,438 ests and 231 genomic sequences from H. glycines (May, 2006). These C. elegans and H. glycines sequences were used to create a local database using SQLServer2000. The sequences were imported into our local database. Subsequently we created a unigene set using the contig assembly program Seqman (DNAStar Inc.; Madison, WI) resulting in 3,782 contigs of 2 or more sequences and 4,522 singletons for H. glycines. These sequences were then blasted against the local C. elegans database. Parsing of the results of the blast searches was done with customized Perl scripts. These scripts extracted the best hits from the blast results, E-value, score and identities values. The parsed results were imported back into the database. SQL scripts were written to query the CeHg database for C. elegans genes having high homology. Our data base was then linked to WormBase [71] and PubMed [72] to identify H. glycines ests homologous to C. elegans unc genes. These results then were confirmed by performing manual blast searches of each C. elegans unc gene against the H. glycines sequences.

RT-PCR

RNA was extracted from nematodes as previously described and treated with DNase I to remove genomic DNA. The cDNA was reversed transcribed from RNA using SuperScript First Strand Synthesis System for RT-PCR (Invitrogen; Grand Island, NY) with oligo d(T) as the primer according to manufacturer's instructions. All the primer sets were initially tested for specificity with a mixture of RNAs for all stages of nematodes. Genomic DNA contamination was assessed by PCR as described previously [19]. We performed this experiment to identify any contaminating genomic DNA that may exist in our cDNA. We used Hg-unc-87 PCR primers (forward primer: 5'GACAACACGGAGATTCCACTTCAG3'; reverse primer, 5'CTGGTCTGGTCGATGCTCTGCTC3') that amplify different size fragments in the presence of genomic DNA as compared to pure cDNA. RT-PCR reactions containing no template and reactions using RNA processed in parallel but with no Superscript reverse transcriptase also served as controls for RT-PCR and produced no amplicon. After we determined that no contaminating genomic DNA existed in our cDNA, we performed RT-PCR. Relative quantities of expression using their respective primers (Fig. 8) were determined using an Mx3000P Real-Time PCR system following manufacturer's instructions (Stratagene; La Jolla, CA). DNA accumulation was measured using SYBR Green and ROX was used as reference dye. Only one product was present in each reaction as indicated by the SYBR Green dissociation curves of amplified products and by assay of terminal reactions by gel electrophoresis in 1% TBE agarose, thus ensuring that the product was of proper size. Template DNA was denatured for 10 minutes at 96°C, followed by PCR cycling temperatures set for denaturing for 30 seconds at 96°C, annealing for 60 seconds at 55°C and extension for 30 seconds at 72°C. The standard curve for the expression comparisons was constructed from the J2 stage sample. The J2 stage sample was diluted over a five-log range and used in parallel RT-PCR assays. All RT-PCR assays were conducted in triplicate. Threshold cycle (Ct) values were plotted against the dilution series. PCR efficiencies were equal between the target and endogenous control. Ct values and relative abundance were calculated using software supplied with the Mx3000P Real-Time PCR system. Our RT-PCR data was standardized against an est (CB380016) determined to experience no change in expression during H. glycines development. The relative abundance of mRNA was compared to that of CB380016 in the different sample types to calculate fold change. For each gene, a ratio was established between the control (CB380016) and the gene of interest (GOI) for the egg J2, 15 dpi and 30 dpi samples. To calculate fold expression, the ratio between CB380016 and the GOI at 15 dpi was set to a value of one. Other fold expression values for egg, J2 and 30 dpi were calculated using the ratio obtained at 15 dpi for GOI as the denominator. The ratio of the GOI for egg, J2 and 30 dpi, respectively, was used as the numerator. The value obtained after calculation was fold expression for those time-points. Standard error was used in the analyses.

Figure 8
figure 8

PCR primer pairs for RT-PCR expression analyses. For the RT-PCR primers, the Genbank match for each unc homolog is provided. The amplicon length is provided in base pairs.

Abbreviations

est:

expressed sequence tag

SCN:

soybean cyst nematode

DMD:

Duchenne muscular dystrophy

LIM:

lin-11, isl-1, mec-3

CeHg:

C. elegans H. glycines database

uncoordinated:

unc

zinc finger:

Zn+2-finger

RT-PCR:

real-time quantitative PCR

nt:

nucleotide

bp:

base pair

J2:

second stage juvenile

dpi:

days post inoculation

References

  1. Brenner S: The genetics of Caenorhabditis elegans. Genetics. 1974, 77: 71-94.

    PubMed Central  CAS  PubMed  Google Scholar 

  2. Sagasti A HN: The CaMKII UNC-43 activates the MAPKKK NSY-1 to execute a lateral signaling decision required for asymmetric olfactory neuron fates. Cell. 105: 221-232. 10.1016/S0092-8674(01)00313-0.

  3. Zengel JM: Identification of genetic elements associated with muscle structure in the Nematode Caenorhabditis elegans. Cell Motility. 1980, 1: 73-97. 10.1002/cm.970010107.

    Article  CAS  PubMed  Google Scholar 

  4. Honda S: Modulation of muscle gene expression in Caenorhabditis elegans: differential levels of transcripts, mRNAs, and polypeptides for thick filament proteins during nematode development. PNAS. 1990, 87: 876-880. 10.1073/pnas.87.3.876.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  5. White GE: The pathway of myofibrillogenesis determines the interrelationship between myosin and paramyosin synthesis in Caenorhabditis elegans. J Exp Biol. 2003, 206: 1899-1906. 10.1242/jeb.00377.

    Article  CAS  PubMed  Google Scholar 

  6. Waterston RH: Muscle. The Nematode Caenorhabditis elegans. Edited by: Wood WB. 1988, Cold Spring Harbor, NY, Cold Spring Harbor Laboratory Press

    Google Scholar 

  7. Epstein HF: Genetic analysis of myosin assembly in Caenorhabditis elegans. Mol Neurobiol. 1990, 5: 1-25.

    Article  Google Scholar 

  8. Rogalski TM: UNC-52/perlecan isoform diversity and function in Caenorhabditis elegans. Biochem Soc Trans. 2001, 29: 171-176. 10.1042/BST0290171.

    Article  CAS  PubMed  Google Scholar 

  9. Segalat L: Dystrophin and functionally related proteins in the nematode Caenorhabditis elegans. Neuromuscul Disord Suppl. 2002, 1: S105-9. 10.1016/S0960-8966(02)00090-1.

    Article  Google Scholar 

  10. Cox EA: Sticky worms: adhesion complexes in C. elegans. J Cell Sci. 2004, 117: 1885-1897. 10.1242/jcs.01176.

    Article  CAS  PubMed  Google Scholar 

  11. Willis JH: Conditional dominant mutations in the Caenorhabditis elegans gene act-2 identify cytoplasmic and muscle roles for a redundant actin isoform. Mol Biol Cell. 2006, 17: 1051-1064. 10.1091/mbc.E05-09-0886.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  12. Mohri K: Enhancement of actin-depolymerizing factor/cofilin-dependent actin disassembly by actin-interacting protein 1 is required for organized actin filament assembly in the Caenorhabditis elegans body wall muscle. Mol Biol Cell. 2006, 17: 2190-2199. 10.1091/mbc.E05-11-1016.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  13. Rosenberg IH: Summary comments. Am J Clin Nut. 1989, 50: 1231-1233.

    Google Scholar 

  14. Kamel HK: Sarcopenia and aging. Nutr Rev. 2003, 61: 157-167. 10.1301/nr.2003.may.157-167.

    Article  PubMed  Google Scholar 

  15. Chow DK: Sarcopenia in the Caenorhabditis elegans pharynx correlates with muscle contraction rate over lifespan. Exp Gerontol. 2006, 41: 252-260. 10.1016/j.exger.2005.12.004.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  16. Chamberlain JS: Muscular dystrophy: the worm turns to genetic disease. Curr Biol. 2000, 10: R795-7. 10.1016/S0960-9822(00)00768-5.

    Article  CAS  PubMed  Google Scholar 

  17. Szewczyk NJ: Genetic defects in acetylcholine signalling promote protein degradation in muscle cells of Caenorhabditis elegans. J Cell Sci. 2000, 113: 2003-2010.

    CAS  PubMed  Google Scholar 

  18. Matthews BF: Molecular characterization of argenine kinase in the soybean cyst nematode (Heterodera glycines). Journal of Nematology. 2003, 35: 252-258.

    PubMed Central  CAS  PubMed  Google Scholar 

  19. Matthews BF: Molecular characterization of a soybean cyst nematode (Heterodera glycines) homolog of unc-87. Journal of Nematology. 2004, 36: 457-465.

    PubMed Central  CAS  PubMed  Google Scholar 

  20. Alkharouf N: SGMD: the soybean genomics and microarray database. Nucleic Acids Res. 2004, 32: D398–D400-10.1093/nar/gkh126.

    Article  PubMed Central  PubMed  Google Scholar 

  21. Khan R: Resistance mechanisms in soybean: Gene expression profile at an early stage of soybean cyst nematode invasion. J Nematology. 2004, 36: 241-248.

    CAS  Google Scholar 

  22. Alkharouf N: Online analytical processing (OLAP): a fast and effective data mining tool for gene expression databases. J Biomed Biotechnol. 2005, 2:

    Google Scholar 

  23. Klink VP: Laser capture microdissection (LCM) and expression analyses of Glycine max (soybean) syncytium containing root regions formed by the plant pathogen Heterodera glycines (soybean cyst nematode). Plant Molecular Biology. 2005, 59: 969-983. 10.1007/s11103-005-2416-7.

    Article  Google Scholar 

  24. Alkharouf N: Analysis of expressed sequence tags from roots of resistant soybean infected by the soybean cyst nematode. Genome. 2004, 47: 380-388.

    Article  CAS  PubMed  Google Scholar 

  25. Alkharouf N: Timecourse microarray analyses reveal global changes in gene expression of susceptible Glycine max (soybean) roots during infection by Heterodera glycines (soybean cyst nematode). Planta, in press. 2006

    Google Scholar 

  26. Alkharouf N: Identification of Heterodera glycines (soybean cyst nematode [SCN]) DNA sequences with high similarity to those of Caenorhabditis elegans having lethal mutant or RNAi phenotypes. Experimental Parasitology. 2006, 115: 247-258. 10.1016/j.exppara.2006.09.009.

    Article  PubMed  Google Scholar 

  27. Wrather JA: Soybean disease loss estimates for the United States from 1996 to 1998. Canadian Journal of Plant Pathology. 2001, 23: 122-131.

    Article  Google Scholar 

  28. Johnsen RC: Mutation. C Elegans II. Edited by: Riddle DLBTMBPJR. 1997, Plainville, NY, Cold Spring Harbor Laboratory Press, 79-97.

    Google Scholar 

  29. Goetinck S: The Caenorhabditis elegans UNC-87 protein is essential for maintenance, but not assembly, of bodywall muscle. J Cell Biol. 1994, 127: 71-78. 10.1083/jcb.127.1.71.

    Article  CAS  PubMed  Google Scholar 

  30. Goetinck S: The Caenorhabditis elegans muscle-affecting gene unc-87 encodes a novel thin filament-associated protein. J Cell Biol. 1994, 127: 79-93. 10.1083/jcb.127.1.79.

    Article  CAS  PubMed  Google Scholar 

  31. Kranewitter WJ: UNC-87 is an actin-bundling protein. J Biol Chem. 2000, 276: 6306-6312. 10.1074/jbc.M009561200.

    Article  PubMed  Google Scholar 

  32. Kovaleva ES: Molecular characterization of the actin gene from cyst nematodes in comparison with those from other nematodes. Comp Parasitol. 2005, 72: 39-49. 10.1654/4138.

    Article  Google Scholar 

  33. Ebashi S: Calcium ion and muscle contraction. Prog Biophys Mol Biol. 1968, 18: 123–183-

    PubMed  Google Scholar 

  34. Ohtsuki I: Regulatory and cytoskeletal proteins of vertebrate skeletal muscle. Adv Prot Chem. 1986, 38: 1–67-

    Google Scholar 

  35. Grabarek ZT: Molecular mechanism of troponin-C function. J Muscle Res Cell Mot. 1992, 13: 383–393-

    Google Scholar 

  36. Ruksana R: Tissue expression of four troponin I genes and their molecular interactions with two troponin C isoforms in Caenorhabditis elegans. Genes Cells. 2005, 10: 261-276. 10.1111/j.1365-2443.2005.00829.x.

    Article  CAS  PubMed  Google Scholar 

  37. Burkeen AK: Disruption of Caenorhabditis elegans muscle structure and function caused by mutation of troponin. I Biophys J. 2004, 86: 991-1001.

    Article  CAS  PubMed  Google Scholar 

  38. McKim KS: The Caenorhabditis elegans unc-60 gene encodes proteins homologous to a family of actin-binding proteins. Mol Gen Genet. 1994, 242: 346-357. 10.1007/BF00280425.

    Article  CAS  PubMed  Google Scholar 

  39. Anyanful A: The RNA-binding protein SUP-12 controls muscle-specific splicing of the ADF/cofilin pre-mRNA in C. elegans. J Cell Biol. 2004, 167: 639-647. 10.1083/jcb.200407085.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  40. Yamashiro S: The two Caenorhabditis elegans actin-depolymerizing factor/cofilin proteins differently enhance actin filament severing and depolymerization. Biochemistry. 2005, 44: 14238-14247. 10.1021/bi050933d.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  41. Ono S: Two Caenorhabditis elegans actin depolymerizing factor/cofilin proteins, encoded by the unc-60 gene, differentially regulate actin filament dynamics. J Biol Chem. 1998, 273:

    Google Scholar 

  42. Mohri K: Actin filament disassembling activity of Caenorhabditis elegans actin-interacting protein 1 (UNC-78) is dependent on filament binding by a specific ADF/cofilin isoform. J Cell Sci. 2003, 116: 4107-4118. 10.1242/jcs.00717.

    Article  CAS  PubMed  Google Scholar 

  43. Ono S: Microscopic evidence that actin-interacting protein 1 actively disassembles actin-depolymerizing factor/Cofilin-bound actin filaments. J Biol Chem. 2004, 279: 14207-14212. 10.1074/jbc.M313418200.

    Article  CAS  PubMed  Google Scholar 

  44. Forbes JG: Titin PEVK segment: charge-driven elasticity of the open and flexible polyampholyte. J Muscle Res Cell Motil. 2006, 8: 1-11.

    Google Scholar 

  45. Small TM: Three new isoforms of Caenorhabditis elegans UNC-89 containing MLCK-like protein kinase domains. J Mol Biol. 2004, 342: 91-108. 10.1016/j.jmb.2004.07.006.

    Article  CAS  PubMed  Google Scholar 

  46. Towers PR LP: Gene expression profiling studies on Caenorhabditis elegans dystrophin mutants dys-1(cx-35) and dys-1(cx18). Genomics. 2006, 88: 642-649. 10.1016/j.ygeno.2006.07.014.

    Article  PubMed  Google Scholar 

  47. Freyd G: Novel cysteine-rich motif and homeodomain in the product of Caenorhabditis elegans cell lineage gene lin-11. Nature. 1990, 344: 876-879. 10.1038/344876a0.

    Article  CAS  PubMed  Google Scholar 

  48. Sadler I: Zyxin and cCRP: Two interactive LIM domain proteins associated with the cytoskeleton. The Journal of Cell Biology. 1992, 119: 1573-1587. 10.1083/jcb.119.6.1573.

    Article  CAS  PubMed  Google Scholar 

  49. Pomiès P: CRP1, a LIM domain protein implicated in muscle differentiation, interacts with a-actin. The Journal of Cell Biology. 1997, 139: 157-168. 10.1083/jcb.139.1.157.

    Article  PubMed Central  PubMed  Google Scholar 

  50. Hobert O: A conserved LIM protein that affects muscular adherens junction integrity and mechanosensory function in Caenorhabditis elegans. Journal of Cell Biology. 1999, 144: 45-57. 10.1083/jcb.144.1.45.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  51. Mercer KB: Caenorhabditis elegans UNC-98, a C2H2 Zn finger protein, is a novel partner of UNC-97/PINCH in muscle adhesion complexes. Mol Biol Cell. 2003, 14: 2492-2507. 10.1091/mbc.E02-10-0676.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  52. Rogalski TM MGP: The UNC-112 gene in Caenorhabditis elegans encodes a novel component of cell-matrix adhesion structures required for integrin localization in the muscle cell membrane. J Cell Biol. 2000, 150: 253-264. 10.1083/jcb.150.1.253.

    Article  PubMed Central  PubMed  Google Scholar 

  53. Lin X QH: C. elegans PAT-6/actopaxin plays a critical role in the assembly of integrin adhesion complexes in vivo. Curr Biol. 2003, 13: 922-932. 10.1016/S0960-9822(03)00372-5.

    Article  PubMed  Google Scholar 

  54. Moulder GL HMM: Talin requires beta-integrin, but not vinculin, for its assembly into focal adhesion-like structures in the nematode Caenorhabditis elegans. Mol Biol Cell. 1996, 7: 1181-1193.

    Article  PubMed Central  PubMed  Google Scholar 

  55. Barnes TM HS: The Caenorhabditis elegans avermectin resistance and anesthetic response gene unc-9 encodes a member of a protein family implicated in electrical coupling of excitable cells. J Neurochem. 1997, 69: 2251-2260.

    Article  PubMed  Google Scholar 

  56. Moerman DG BGM: Identification and intracellular localization of the unc-22 gene product of Caenorhabditis elegans. Genes Dev. 1988, 2: 93-105.

    Article  PubMed  Google Scholar 

  57. Benian GM KJE: Sequence of an unusually large protein implicated in regulation of myosin activity in C. elegans. Nature. 1989, 342: 45-50. 10.1038/342045a0.

    Article  PubMed  Google Scholar 

  58. Charlie NK SMA: Presynaptic UNC-31 (CAPS) is required to activate the G alpha(s) pathway of the Caenorhabditis elegans synaptic signaling network. Genetics. 2006, 172: 943-961. 10.1534/genetics.105.049577.

    Article  PubMed Central  PubMed  Google Scholar 

  59. Rogalski TM WBD: Products of the unc-52 gene in Caenorhabditis elegans are homologous to the core protein of the mammalian basement membrane heparan sulfate proteoglycan. Genes Dev. 1993, 7: 1471-1484.

    Article  PubMed  Google Scholar 

  60. Rogalski TM GEJ: Mutations in the unc-52 gene responsible for body wall muscle defects in adult Caenorhabditis elegans are located in alternatively spliced exons. Genetics. 1995, 139: 159-169.

    PubMed Central  PubMed  Google Scholar 

  61. Lundquist EA HRK: UNC-115, a conserved protein with predicted LIM and actin-binding domains, mediates axon guidance in C. elegans. Neuron. 1998, 21: 385-392. 10.1016/S0896-6273(00)80547-4.

    Article  PubMed  Google Scholar 

  62. Struckhoff EC LEA: The actin-binding protein UNC-115 is an effector of Rac signaling during axon pathfinding in C. elegans. Development. 2003, 130: 693-704. 10.1242/dev.00300.

    Article  PubMed  Google Scholar 

  63. Kunkel MT: Mutants of a temperature-sensitive two-P domain potassium channel. J Neurosci. 2000, 20: 7517-7524.

    CAS  PubMed  Google Scholar 

  64. Grady RM ZH: Maturation and maintenance of the neuromuscular synapse: genetic evidence for roles of the dystrophin--glycoprotein complex. Neuron. 2000, 25: 279-293. 10.1016/S0896-6273(00)80894-6.

    Article  PubMed  Google Scholar 

  65. McArdle A ERH: Time course of changes in plasma membrane permeability in the dystrophin-deficient mdx mouse. Muscle Nerve. 1994, 17: 1378-1384. 10.1002/mus.880171206.

    Article  PubMed  Google Scholar 

  66. Spanier B SSR: Caenorhabditis elegans neprilysin NEP-1: an effector of locomotion and pharyngeal pumping. J Mol Biol. 2005, 352: 429-437.

    Article  PubMed  Google Scholar 

  67. de la Cruz IP: sup-9, sup-10, and unc-93 may encode components of a two-pore K+ channel that coordinates muscle contraction in Caenorhabditis elegans. J Neurosci. 2003, 23: 9133-9145.

    PubMed  Google Scholar 

  68. Carre-Pierrat M: The SLO-1 BK channel of Caenorhabditis elegans is critical for muscle function and is involved in dystrophin-dependent muscle dystrophy. J Mol Biol. 2006, 358: 387-395. 10.1016/j.jmb.2006.02.037.

    Article  CAS  PubMed  Google Scholar 

  69. Sardanelli S KWJ: Soil Moisture Control and Direct Seeding for Bioassay of Heterodera glycines on Soybean. Journal of Nematology (Supplement). 1997, 29: 625-634.

    Google Scholar 

  70. Mujer CV: Chloroplast genes are expressed during intracellular symbiotic association of Vaucheria litorea plastids with the sea slug Elysia chlorotica. Proc Natl Acad Sci USA. 1996, 93: 12333-12338. 10.1073/pnas.93.22.12333.

    Article  PubMed Central  CAS  PubMed  Google Scholar 

  71. Wormbase. [http://www.wormbase.org/]

  72. PubMed. [http://www.ncbi.nlm.nih.gov/PubMed/]

  73. Moerman DG: Muscle: structure, function and development. C Elegans II. Edited by: Riddle DLBTMBPJR. 1997, Plainville, NY, Cold Spring Harbor Laboratory Press, 417-470.

    Google Scholar 

  74. Mackinnon AC: C. elegans PAT-4/ILK functions as an adaptor protein within integrin adhesion complexes. Curr Biol. 2002, 12: 787-797. 10.1016/S0960-9822(02)00810-2.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

We gratefully acknowledge support from the United Soybean Board project number 5214. The authors thank Andrea Skantar, Mark Tucker, and Susan Meyer for critical reading of the manuscript. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the United States Department of Agriculture.

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Benjamin F Matthews.

Additional information

Vincent P Klink, Veronica E Martins contributed equally to this work.

Authors’ original submitted files for images

Below are the links to the authors’ original submitted files for images.

Authors’ original file for figure 1

Authors’ original file for figure 2

Authors’ original file for figure 3

Authors’ original file for figure 4

Authors’ original file for figure 5

Authors’ original file for figure 6

Authors’ original file for figure 7

Authors’ original file for figure 8

Authors’ original file for figure 9

Authors’ original file for figure 10

Authors’ original file for figure 11

Authors’ original file for figure 12

Authors’ original file for figure 13

Authors’ original file for figure 14

Authors’ original file for figure 15

Authors’ original file for figure 16

Authors’ original file for figure 17

Authors’ original file for figure 18

Authors’ original file for figure 19

Rights and permissions

Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Reprints and Permissions

About this article

Cite this article

Klink, V.P., Martins, V.E., Alkharouf, N.W. et al. A decline in transcript abundance for Heterodera glycines homologs of Caenorhabditis elegans uncoordinatedgenes accompanies its sedentary parasitic phase. BMC Dev Biol 7, 35 (2007). https://doi.org/10.1186/1471-213X-7-35

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/1471-213X-7-35

Keywords