Skip to main content

Table 3 Primers used to detect LoxP and Ywhah

From: YWHA (14-3-3) protein isoforms and their interactions with CDC25B phosphatase in mouse oogenesis and oocyte maturation

PCR product PCR primers Fragment size (bp)
Ywhah LoxP Forward: 5′- TAATTGTGAGCCACCCGAAATGA − 3′
Reverse: 5′- GCCAACGACCAATGCCAATTATAG − 3′
WT: 226
Floxed: 292
Ywhah knockout Forward: 5′- CCTGATCTAGGATAGCTAGGGCTACATAG − 3′
Reverse: 5′- AGTATACCTTTTGGAGACAGGATCTATTATAGCC − 3′
Deletion gives band at: 390
Ywhae LoxP Forward: 5′- GCATGTGTTTGTCTGTCAGAGGAC − 3′
Reverse: 5′- AGGTACCAAAACAGTAAGCCATCTCCCTA − 3′
WT: 450
Floxed: 536
Ywhae knockout Forward: 5′- TTCTTTTGTAGAAATTGGGGAAGGTCATGG − 3′
Reverse: 5′- AGGTACCAAAACAGTAAGCCATCTCCCTA − 3′
Deletion gives band at: 664
Generic Cre Forward: 5′- GCG GTC TGG CAG TAA AAA CTA TC − 3′
Reverse: 5′- GTG AAA CAG CAT TGC TGT CAC TT − 3′
Cre Positive: 100