Skip to main content

Table 1 Primer Sequences for Qualitative Real-Time Polymerase Chain

From: Sonic hedgehog promotes chondrogenesis of rabbit bone marrow stem cells in a rotary cell culture system

GenePrimer nucleotide sequence
ShhForward: CTGACCGTGACCGTAGCAAGT
Reverse: TGGATGTGGGCTTTGGACTCA
Sox 9Forward: CTGACCGTGACCGTAGCAAGT
Reverse: TGGATGTGGGCTTTGGACTCA
ANCNForward: ATGGCTTCCACCAGTGCG
Reverse: CGGATGCCGTAGGTTCTCA
collagen IIForward: GCTCCCAGAACATCACCTACCA
Reverse: ATTCCTGCTCAGGCCCTCC
collagen XForward: CCCTTCTGCTGCTAGTGTC
Reverse: GTCTTGGTGTTGGGTTGT
RUNX2Forward: CCTTCCACTCTCAGTAAGAAGA
Reverse: TAAGTAAAGGTGGCTGGATAGT
ALPForward: CCTCTTGGGTCTCTTTGAGC
Reverse: CAATCCTGCCTCCTTCCA
PPAR-γForward: GCATCCCCACCCTACTATTCTG
Reverse: GAGGGAGTTGGAAGGCTCTTC
leptinForward: GTCGTCGGTTTGGACTTCATC
Reverse: CGGAGGTTCTCCAGGTCGTTG
Annexin VForward: GCAGAACTAACAGCCATAA
Reverse: AGAACCACCAACATCCTC
B2MForward: AACGTGGAACAGTCAGACC
Reverse: AGTAATCTCGATCCCATTTC