Skip to main content

Table 2 Characteristics of hoxb1a and hoxb1b germ line mutant alleles

From: Targeted germ line disruptions reveal general and species-specific roles for paralog group 1 hox genes in zebrafish

Founder Transmission frequency Sequencea Type of mutationb IDc
hoxb1a   TTTGTAACCGTGGGACGAACGCCTACT   
A2 14% TTTGTAAC GTGGGACGAACGCCTACT Deletion (−1 bp) um189
   TTTGTACACAATTTGTACAATTTGGACGAACGCCTACT Insertion/deletion (+17 bp) um190
   TTTGTACGGG  GGACGAACGCCTACT Insertion/deletion (−5 bp) um191
   TTTGTACTCCATTTGTA    CTACT Insertion/deletion (−5 bp) um192
A20 9% TT      TGGGACGAACGCCTACT Deletion (−8 bp) um193
   TTTGTAATTTC GGACGAACGCCTACT Insertion/deletion (−2 bp) um194
hoxb1b   ATCGCAGCCCTTCCACCTCAACGTGGACATGGG   
B2 45% ATCGCAGCCCTTCCACCTCAACGTGGACATGGG Deletion (−8 bp) um195
B11 43% ATCGCAGCCCTTCCACATTCC GTGGACATGGG Insertion/deletion (−1 bp) um196
B15 41% TGTTTCAATCGTGAAACACAAATTCACAAATTCAATCGTGGACATGG Insertion/deletion (+19 bp) um197
  1. aSequence of mutant alleles. Deletions are shown as gaps and insertions are italicized. Nucleotides in bold indicate target site for diagnostic restriction enzyme in wild type sequence.
  2. bIndicates whether mutation results from insertion, deletion or both. Numbers in parenthesis indicate net gain/loss of nucleotides in mutant sequence.
  3. cIdentifying designation for each mutant allele.