Skip to main content

Table 1 qRT-PCR primer sequences used in this study

From: Natriuretic peptides and Forkhead O transcription factors act in a cooperative manner to promote cardiomyocyte cell cycle re-entry in the postnatal mouse heart

Gene name Forward Reverse
Anp/Nppa GGGTAGGATTGACAGGATTGG CTCCTTGGCTGTT ATCTTCGG
Bnp/Nppb CTGAAGGTGCTGTCCCAGAT CCTTGGTCCTTCAAGAGCTG
18 s TCAAGAACGAAAGTCGGAGG GGACATCTAAGGGCATCAC
Npr1 GTGAAACGTGTGAACCGGAA AGCTCCCACAAATCTGGTCA
Npr2 GCTGACCCGGCAAGTTCTGT ACAATACTCGGTGACAATGCAGAT
Npr3 GTTCCAAATGCGATCGAATGT CCCACAACGATTCCTGTCACT