Skip to main content

Table 1 Nucleotide sequence of the forward and reverse primers used for quantitative PCR

From: Importance of prostate androgen-regulated mucin-like protein 1 in development of the bovine blastocyst

Gene Accession number Forward primer Reverse primer
ATF6 BC120388 TCATAGGCACGAAGTGGAAAG CCAGAGCACCCTGAAGAATAC
DDIT3 NM_001078163 CTCTCTGGCTTGGCTTACTG GTTCTTCCTTGGTCTTCCTCTT
EIF2AK3 NM_001098086.1 GCTATCAAGAGAATCCGTCTCC TCTCACAATTCCTGGGTGTTC
PARM1 NM_001075771.2 AGCTCTACTCTCACACCTACTT GTGGTGGTCTCCATGTCTATC
GAPDH NM_001034034 TTCAACGGCACAGTCAAGG ACATACTCAGCACCAGCATCAC
YWHAZ BM446307 GCATCCCACAGACTATTTCC GCAAAGACAATGACAGACCA