Skip to main content

Table 1 Sequences of primers used in the present study

From: Molecular cloning and characteristics of DnaJa1and DnaJb1 in Coilia nasus: possible function involved in oogenesis during spawning migration

Primer Name F—Forward/R—Reverse DNA-Sequence 5′-3′ Annealing Temperature (°C) Fragment Size (bp)
Gene-specific Primer pairs for RACE (GsP)
 Gspdnaja1–5′ 5’ –TTACCGTGTCTTTGGAGGAACTG − 3′ 61.0 -
 Gspdnaja1–3′ 5’–GCAACTCCATAGCCATAACCAG − 3’ 59.2 -
 Gspdnajb1–5′ 5’- GCGACGAGACGCCAACCAACA − 3’ 68.6 -
 Gspdnajb1–3’ 5’- GGGATGTTGGTTGGCGTCTCGTC − 3’ 69.4 -
Primers for RT-qPCR
 Dnaja1-F 5′ –AAAACCCAGCAGAAGGAGACA-3′ 58.9 259
 Dnaja1-R 5’ –AGTTCCTCCAAAGACACGGTAAG-3’ 59.6  
 Dnajb1-F 5’-GCGACGAGACGCCAACCAACA-3′ 68.6 151
 Dnajb1-R 5′-GGGACGCTCACCGTACAACCACA − 3’ 68.7  
18sRNA primers
 18sRNA-R 5′- TGATTGGGACTGGGGATTGAA-3′ 59.2 232
 18sRNA-F 5′- TAGCGACGGGCGGTGTGT-3′ 62.4