Skip to main content

Table 3 Specific primers used to amplify the transcripts of NKL genes from cDNA of the onychophoran E. rowelli

From: Expression of NK genes that are not part of the NK cluster in the onychophoran Euperipatoides rowelli (Peripatopsidae)

Gene Fragment length (in bases) Direction Primer sequence Annealing Temperature (°C)
NK2.1 823 Forward TTCTGCATAATAAGGCGGGC 62
Reverse TTACCACTCCCGTCATTTCC
vax 543 Forward TATCGACTGTCTCCTCTGTCC 62
Reverse AAAGACGGCCTTCGAAATGGC
Emx 742 Forward CCACGCCTATAGTTCCTAAGC 62
Reverse TCCTCACCTTGAAGTGTCTCC
Nedx 795 Forward ATGGAAGAAGAGGCCACCAG 62
Reverse AGGAGGAATGACACCCATAGG
Hhex 696 Forward CATTGGGATGGCTACCTATGG 62
Reverse CCTGTACTGCTAGCAACAACC
Bari 411 Forward CAAACTACTAAATCAAAGAAACCGAGA 62
Reverse TTAGTGTTGACACCCAGGTACAAACAT
BarH 680 Forward GGAGGGTTCTAGCAGTAATGC 58
Reverse GTGTTGGATAGGGCCAATAGG