Skip to main content


Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers

From: Swimming exercise to control precocious maturation in male seabass (Dicentrarchus labrax)

Gene FW/RV Sequence (5′ > 3′) Length Tm GC% Self complementarity Self 3′ complementarity Product length AC Authors
igf1 Forward primer GGCTTGGCTAATCTAACTGGCTTC 24 61.75 50.00 4.00 0.00 160 GQ924783.1 Crespo et al. 2013
Reverse primer TCGCTCAGGGGTTTCATCACTAC 23 62.24 52.17 3.00 0.00
amh Forward primer TGCAGAGCAAAGCCTGAAAG 20 59.04 50.00 4.00 1.00 126 AM232701.1 Diaz et Piferrer, 2015
Reverse primer TCAACGGGGAACAAAGACAA 20 57.58 45.00 2.00 0.00
fshr Forward primer ACTCCACCTCCATCATCTGC 20 59.16 55.00 3.00 2.00 177 AY642113.1 Rocha et al. 2007
Reverse primer AACGGGGAACAGTCAGTTTG 20 58.32 50.00 5.00 1.00
bmp15 Forward primer GGCAGATTTGATGGGTCATT 20 56.05 45.00 4.00 1.00 117 AM933668.1 Halm et al. 2008
Reverse primer CTTTAACAGGAACGGCGAAG 20 57.12 50.00 4.00 0.00
erβ2 Forward primer GAGCTGGAGAGCAGGAACAA 20 60 55.00 4.00 0.00 61 AJ489524.1 Designed, partial sequence from Halms et al. 2007
Reverse primer AGACCAGAGCATCGATCACC 20 60 55.00 6.00 2.00
gsdf1 Forward primer ACAGAGCTGCCTTGCAATCC 20 60.96 55.00 6.00 4.00 99 JQ755271.1 Crespo et al. 2013
Reverse primer TCTTGTATGACAAAGCCTGCC 21 58.56 47.62 6.00 1.00
arα Forward primer CCCCGGATCTTGTGTTCA 18 60 55.56 4.00 2.00 70 AY647256.1 Designed, comlete sequence from Blazquez et Piferrer, 2015
Reverse primer TTCATCCGTATGCAGTGTTCA 21 60 42.86 6.00 2.00
3βhsd Forward primer CACCCTACAAGAGCTACGAGGA 22 60 54.55 4.00 0.00 96 JQ861952.1 Designed, partial sequence from Mazon et Gomez, 2012
Reverse primer CCAGAACCCAGAGGACCAG 19 60 63.16 3.00 1.00
11βhsd Forward primer GGAAATGCTGGCAACCAC 18 60 55.56 4.00 2.00 65 AF449173.2 Designed, complete sequence from Mylonas et al. 2007
Reverse primer CACGAACACGGAGCAACA 18 60 55.56 2.00 0.00
smc1β Forward primer TTCAGACCGATGGACAACCT 20 60 50.00 3.00 0.00 87 KF699104.1 This study
Reverse primer GGCGGGTTTGTAACTGTGAA 20 60 50.00 3.00 1.00
inhba Forward primer TCATCAAGAAGGACATCCAGAA 22 58.62 40.91 4.00 1.00 62 HE967317.1 Designed, complete sequence from Garcia-Lopez et al. 2012
Reverse primer GGTTCGGTGTTTACGAGCAG 20 59.21 55.00 3.00 1.00
l17 Forward primer CTGGCTTGCCTTTCTTGACT 20 60 50.00 4.00 1.00 201 AF139590 Versamos et al. 2006
Reverse primer GAGGACGTGGTGGTTCATCT 21 60 55.00 4.00 0.00
  1. Forward (FW) and reverse (RV) primer sequences (5′ > 3′), their characteristics (length, guanine-cytosine content (GC%)) and qPCR conditions (melting temperature Tm, self-complementarity, self-complementarity of the 3′ end and product length) for the seabass gene expressions analysed in this study: insuline-like growth factor 1 (igf 1), anti-mullerian hormone (amh), follicle stimulating hormone receptor (fshr), bone morpho-genetic protein (bmp15), estrogen receptor- beta (erβ2), gonado-somal derived factor 1 (gsdf1), androgen receptor-alpha (arα), 3-beta-hydroxysteroid dehydrogenase (3βhsd), 11-beta hydroxysteroid dehydrogenase (11βhsd), structural maintenance of chromosomes protein 1B (smc1β), inhibin beta a (inhba), ribosomal protein L 17 (i17) and the literature reference reporting on the specific primers. Authors and accession numbers (AC) of the used primers are indicated