A parental requirement for dual-specificity phosphatase 6 in zebrafish

Table 1 Characteristics of CRISPR guide RNAs targeting dusp6 and dusp2

CRISPR guide	Target coordinate ^a	Target sequence ^b	Strand ^c	Size of mutant PCR band ^d	Mutagenesis rate ^e
dusp6-5′	Chr25:18233489	GAGCCTCATGCTCCGGCGAC	–	~ 564 bp	2/23
dusp6-3′	Chr25:18231243	CTCGAGTCCACGTGAGGTCC	–	~ 564 bp	2/23
dusp2-5′	Chr8:40589831	GGCGACCCTCTCGAGATCTC	+	~ 392 bp	3/23
dusp2-3′	Chr8:40592681	ACACTGTGACAGATCTACAA	+	~ 392 bp	3/23

^aTarget coordinate defined by the first nucleotide of the target sequence
^bGenomic sequence targeted by the guide RNA
^cStrand of genomic DNA which is targeted by the guide RNA
^dPCR product size if a CRISPR-induced deletion is present (see Additional file 2 for primer sequences)
^eThe number of F0 germ line positive founders identified out of those screened

ISSN: 1471-213X