Skip to main content

Table 1 Characteristics of CRISPR guide RNAs targeting dusp6 and dusp2

From: A parental requirement for dual-specificity phosphatase 6 in zebrafish

CRISPR guide Target coordinate a Target sequence b Strand c Size of mutant PCR band d Mutagenesis rate e
dusp6-5′ Chr25:18233489 GAGCCTCATGCTCCGGCGAC ~ 564 bp 2/23
dusp6-3′ Chr25:18231243 CTCGAGTCCACGTGAGGTCC
dusp2-5′ Chr8:40589831 GGCGACCCTCTCGAGATCTC + ~ 392 bp 3/23
dusp2-3′ Chr8:40592681 ACACTGTGACAGATCTACAA +
  1. aTarget coordinate defined by the first nucleotide of the target sequence
  2. bGenomic sequence targeted by the guide RNA
  3. cStrand of genomic DNA which is targeted by the guide RNA
  4. dPCR product size if a CRISPR-induced deletion is present (see Additional file 2 for primer sequences)
  5. eThe number of F0 germ line positive founders identified out of those screened