Skip to main content

Table 1 Primers used for RT-qPCR and probe amplification. For dntm3aa, the same forward primer was used in both reactions

From: Phylogeny, expression patterns and regulation of DNA Methyltransferases in early development of the flatfish, Solea senegalensis

Target Primer Sequence (5′ → 3′) Amplicon (bp) Application
dnmt1 F GCCGTCAAGTCACCGACCGCTCCTAA 132 qPCR
R CATTGACAAGATGGTTGGCTGTTTCCCA
F TGCACGTGTTTGCGCCCAGAGCTT 669 WISH
R GAGCGCACTCCCTCACACTGACCACT
dnmt3aa F CGCCCTCACAGCAACACACAGACCCT 126 qPCR
R CGATGACGAAGCCCCGCCCATCC
R CCGCACATGTAGCAGTTCCACGGGTCCTCT 994 WISH
dnmt3ab F TAGAGCCACCAGAGGAGGAGCGCAAT 86 qPCR
R GGGGCGTGTAGGCTGCCGCTT
F CATCATCCACCACCGCCACTGCCAC 774 WISH
R TGCCGCTTCTGGCTCCACCCACATC
dnmt3bb.1 F CGGACTGAACCCACACGCGCTCAACA 93 qPCR
R AGGACACGAGGACCACCAACGCACAG
F CGGACTGAACCCACACGCGCTCAACA 963 WISH
R AGCAGAACCTCTCGACCACCGCAGCAA
\