Fig. 3

A single mariner insertion in the Cysu gene causes the collapsed wing defect. (a) A mariner insertion (MiET1) in the Cysu gene was available through Fly Base. Arrowheads indicate PCR primers encompassing the insertion point. (b) An expected 577-bp PCR band was amplified from wild-type (+/+) and insertion heterozygote (m/+) DNA. The same band is missing in the insertion homozygote (m/m). PCR amplification was performed with simultaneous amplification of an adjacent insertion-free region, which amplified a 333-bp DNA fragment in all genotypes. (c) A final confirmation on Minos insertion was obtained by amplifying a 540 bp fragment from inside the insertion (F 5′ AAGAAAAACCGAAGTGCGCC 3′ R5′ AGAGAGAACCGTCGCCAAAG 3′) and a 222 bp fragment by setting a primer inside the element and one outside in Cysu DNA (Cysu: F1 5′ TCGAAAAGTTGACGGCAGGA3′ Minos: R1 5′ TAGTGGTTGGGGCTCGTAGA 3′ (d) Wild type wing (e) A homozygous Mi{ET1} insertion in the Cysu sequence displays a severe wing defects in adults. (f) Activated CysuRNAi with a ubiquitous actin-GAL4 driver also shows the same collapsed wing phenotype seen in the insertion mutant. (g) Rescue of the collapsed wing phenotype with a UAS-Cysu ⁺ GFP transgene. Inset shows ubiquitous GFP expression with Actin-GAL4 driver. The mounted wings are shown from each genotype (D′-G′). (H) Cysu mutant adults have a significantly shorter life span compared to the wild type control