Skip to main content

Table 2 Sequences of primers used for ChIP-qPCR analyses

From: BRG1 interacts with GLI2 and binds Mef2c gene in a hedgehog signalling dependent manner during in vitro cardiomyogenesis

Target Location (mm10) Forward primer Reverse primer
β-actin Chr 5:142,906,954 - 142,907,148 GATGCTGACCCTCATCCACT ATGAAGAGTTTTGGCGATGG
Gene Desert Chr 15: 70,644,478 - 70,644,564 TCCTCCCCATCTGTGTCATC GGATCCATCACCATCAATAACC
Mef2c site A Chr 13: 83,417,148 - 83,417,378 TGAAAAAGGAAATATCCCACTTAGA TTGCATGGGTTCACACCTAA
Mef2c site B Chr 13: 83,450,400 - 83,450,695 AGTTGCCTGAGCCTGTTTTC TTTTTCGGCAATGATTTTCC
Mef2c site C Chr 13: 83,517,957 - 83,518,157 CTTTCGGCTGGAGAGTCTTG TCTCCAGTTCCTGGGAAGAA
Mef2c site D Chr 13: 83,524,812 - 83,524,937 ACACACGCACACTTCGTCTC GACCCACACAGAACCTTCAAA
Mef2c site E Chr 13: 83,595,419 - 83,595,594 TTCCCATTTGGACCATTACC ACCCACGCACTGAGACTTTC
Mef2c site F Chr 13: 83,633,148 - 83,633,305 AACCCCAATCTTCTGCCACT AAGCTTTCGCTAGACGTGGA
Mef2c site G Chr 13: 83,660,831 - 83,661,075 GAGCCCCCTCTCTAATGTCC TGTGGGCAAGTGTCTTTCTG
Mef2c site H Chr 13: 83,664,180 - 83,664,382 AAGTGACATTTGGGGGTCCT CGACCGACCTGCTTTACTTG
Mef2c site I Chr 13: 83,739,543 - 83,739,715 CCTAATTATTTCAGTTTGGGATGC CCTCCCCTCTTGTCAAAGTGT
  1. Chr Chromosome