Skip to main content

Table 1 Sequences of primers used for real time qPCR analyses

From: BRG1 interacts with GLI2 and binds Mef2c gene in a hedgehog signalling dependent manner during in vitro cardiomyogenesis

Target Forward Primer Reverse Primer
β-actin AAATCGTGCGTGACATCAAA AAGGAAGGCTGGAAAAGAGC
Ascl1 ACTTGAACTCTATGGCGGGTT CCAGTTGGTAAAGTCCAGCAG
Brachyury CTGGACTTCGTGACGGCTG TGACTTTGCTGAAAGACACAGG
Brg1 CAAAGACAAGCATATCCTAGCCA CACGTAGTGTGTGTTAAGGACC
Flag-Gli2 S662A GGACTACAAGGACGACGATGA CAGAGGACAGGCCTTTTTCC
Gata-4 AAAACGGAAGCCCAAGAACCT TGCTAGTGGCATTGCTGGAG
Gli1 CCAAGCCAACTTTATGTCAGGG TCCTAAAGAAGGGCTCATGGTA
Gli2 CAACGCCTACTCTCCCAGAC GAGCCTTGATGTACTGTACCAC
Mef2c TCTGTCTGGCTTCAACACTG TGGTGGTACGGTCTCTAGGA
Mesp1 CATCGTTCCTGTACGCAGAA TCTAGAAGAGCCAGCATGTCG
Myhc6 GGGACATTGGTGCCAAGAAGA ATTGTGGATTGGCCACAGCG
Myhc7 ACTGTCAACACTAAGAGGGTCA TTGGATGATTTGATCTTCCAGGG
Nkx2-5 AAGCAACAGCGGTACCTGTC GCTGTCGCTTGCACTTGTAG
Pax3 TTTCACCTCAGGTAATGGGACT GAACGTCCAAGGCTTACTTTGT
Ptch1 AAAGAACTGCGGCAAGTTTTTG CTTCTCCTATCTTCTGACGGGT
Tbx5 CTTTCGGGGCAGTGATGAC TTGGATGAGGTGGAGAGAGC