Skip to main content

Table 1 Primer sequences.

From: Gene expression profiles during early differentiation of mouse embryonic stem cells

A) Marker/Housekeeping genes (note: Brachyury, Beta-actin, Hprt and Gapdh also came up in the arrays)
Gene Primer sequence PCR fragment size (bp)
Oct4 F GAGCACGAGTGGAAAGCAAC 521
Oct4 R CGCCGGTTACAGAACCATAC  
NANOG F TTACAAGGGTCTGCTACTGAGATG 431
NANOG R GCAATGGATGCTGGGATACT  
18Smm F GTAACCCGTTGAACCCCATT 150
18Smm R CCATCCAATCGGTAGTAGCG  
GscF CAGATGCTGCCCTACATGAAC 157
GscR TCTGGGTACTTCGTCTCCTGG  
Fgf5 F TGTGTCTCAGGGGATTGTAGG 136
Fgf5 R AGCTGTTTTCTTGGAATCTCTCC  
KDR F TTTGGCAAATACAACCCTTCAGA 112
KDR R GCAGAAGATACTGTCACCACC  
Hprt F CACGGACTAGAACACCTGC 229
Hprt R GCTGGTGAAAAGGACCTCT  
Brachyury F CATGTACTCTTTCTTGCTGG 312
Brachyury R GGTCTCGGGAAAGCAGTGGC  
GATA4 F CCCTACCCAGCCTACATGG 138
GATA4 R ACATATCGAGATTGGGGTGTCT  
Rex1 F CGTGTAACATACACCATCCG 128
Rex1 R GAAATCCTCTTCCAGAATGG  
Nestin F CCGCTTCCGCTGGGTCACTGT 227
Nestin R CTGAGCAGCTGGTTCTGCTCCT  
NodalF TTCAAGCCTGTTGGGCTCTAC 162
Nodal R TCCGGTCACGTCCACATCTT  
GapdhF: ACCACAGTCCATGCCATCAC 432
Gapdh R: TCCACCACCCTGTTGCTGTA  
B-actinF: CGTGGGCCGCCCTAGGCACCA 242
B-actin R: TTGGCCTTAGGGTTCAGGGGG  
B) Primers, Confirmed and interesting genes:
GSE8766   
Gene Primer sequence PCR fragment size (bp)
Aur F AAATTGAAAGGAATCAGACTAGA 147
Aur R GACCACTGTCTGTAACACCC  
Atp5b F CCTGCATGGAAGGAAACCTG 238
Atp5b R GTCACATGGGGAAGCTGGTG  
HnrpkF: CCCCAACCCTGTTTGTAAGG 293
HnrpkR: GGACCAGATACAGAACGCACA  
Dppa5F: TCGGAGACACAAGGACTGGA 269
Dppa5R: CCCACAGGGATCTCGAATGTC  
SgceF: TGTCACGGTATTTGGTTCTCAA 170
SgceR: CGCAGACTACAGGTAAATGGTA  
Rplp1F: ACCGAAGCCCATGTCATCTT 211
Rplp1R: CTTTCTGGCCTGGCTTGTTT  
Ssr2F: TGGTTGAGTTCGGGGTAAGA 274
Ssr2R: AGCGGGAGTTTGACAGGAGA  
Hspa8F: GGGTTGCAGACTTTCTCCAGT 239
Hspa8R: AAGGCTGAGGATGAGAAGCA  
Eif4a1 F: CATCCAGCAGCGAGCTATTC 271
Eif4a1R: CAGCTTCTGCACCTCAGCAC  
Rpl8 F: CTCCAAAGGGATGCTCCACA 238
Rpl8R: GCCACAGTCATCTCCCACAA  
Hspca1F: ATCTGCACCAGCCTGCAAAG 176
Hspca1R: AACTGGACTCGGGGAAGGAG  
BG063704 F: GAACTCCAGACCTCCAGACCA 184
BG063704 R: TTGCTTTGGGCAACAACTGA  
Rps2F: TACCTGTTCTCCCTGCCCATT 180
Rps2R: AACACCAAGACCAACGTGACC  
BG069915F: GGAGTATGGAACGACCCTCTCA 201
BG069915R: GAGCAGTGATTCTCAACCTTGC  
BG067484F: GCCTCGATCAGAAGGACTTG 193
BG067484R: GACCCGCTGAATTTAAGCAT  
BG067621F: GCTCCCAAGATCCAACTACGA 257
BG067621R: AGCCTGAGAAACGGCTACCA  
Cox4i1F: CGCAGTGAAGCCAATGAAGA 246
Cox4i1R: GCTTTCCCCACTTACGCTGA  
Ftl1F: GCTGCCTAGTGGCTTGAGAGG 216
Ftl1R: ATGGGCAACCATCTGACCAA  
TktF: TATGGACTGGCCCTCGCTAA 286
TktR: GGGAGCCACAGAGGTTGATG  
BG063737F: GACGAGCACACAGGGAAACC 300
BG063737R; GGAGAGAAGGAGGGGCAAGA  
BG069482F: CCCTCGGATACCTGATGCTG 167
BG069482R: TGAGAAATGACGGAGCCTTG  
Tubb5F: TGGGAGGTGATAAGCGATGAA 257
Tubb5R: GGCCTTTAGCCCAGTTGTTG  
Rps28 F: CAGGTGCGAGTGGAATTCATG 198
Rps28 R: TGCTTTATTTAACAGTTGCAGATCA  
H3133B01F: CAGCCATTCAGCAAAGGAGA 283
H3133B01R: TCTTGGGCAGGGTCTGTAGG  
H3134D10 F: GCTCGGCTGTGTCAAGATGAAG 227
H3134D10 R: CATGGGTCAGAACACCTTGCTT  
GSE8625:   
Mki67F: CCTTGGCTTAGGTTCACTGTCC 250
Mki67R: TGCAGAATCCAGATGATGGAGC  
PterF; CATGTCCCACCTTGACAGGAC 245
PterR; CCGTACTTCATCAACCGATGC  
Scmh1F: GGACCCAGTGTAGGAAGAGAGACC 206
Scmh1R: ATTGCTTCTGGCGTTTGGAC  
  1. Primers in bold were also used for Q-PCR.