Skip to main content

Table 3 Primers for RT-PCR and quantitative real-time-PCR analysis

From: Deaf-1 regulates epithelial cell proliferation and side-branching in the mammary gland

RT-PCR
Transcript Sequence (5'-3') Annealing Temp (x°C) Amplicon size (bp)
Rac3    
forward GATGGTGGATGGGAAGCCAGTTAAC 68 300
reverse GGATGGCCTCGTCGAACACTGTC   
HPRT    
forward CACAGGACTAGAACACCTGC 65 (+ 5% glycerol) 229
reverse GCTGGTGAAAAGGACCTCT   
Quantitative real-time PCR
Transcript Sequence (5'-3')   Amplicon size (bp)
Deaf-1    
forward AGAATGAGCTGCCCACAACT   133
reverse TCAAAGGTCAGTGCTCCAGA   
Rac3    
forward CACACACACCCATCCTTCTG   100
reverse TAGGTTATGGGTGCCAGCTT   
18S rRNA    
forward GTAACCCGTTGAACCCCATT   152
reverse CCATCCAATCGGTAGTAGCG   
CK18    
forward CAAGATCATCGAAGACCTGAGGC   384
reverse TGTTCATACTGGGCACGGATGTCC