Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer codes.

From: Expression of zebrafish pax6b in pancreas is regulated by two enhancers containing highly conserved cis-elements bound by PDX1, PBX and PREP factors

Primer code Sequence
BP249 CGGGCTCCATCCGACCG
BP251 CAGGTTGCGTAGCACTCGG
BP311 CATTATTGTTGCCAGCACGAAGCATC
BP313 AGTAGACAGGCACGTCCTGGATGT
BP559 GACAGACAGATAGACAGAAAGATAG
BP560 CAGGATGTGGAGTAAAGGTGAAGC
BP563 TTTCCTAGCAGCTTTATTTTTATGA
BP566 TGTCGTCACAGTTTTCTTTCAGA
BP567 TGAGGGGGAGAGAGACACATAG
BP568 AATCAGTCAAAACGAGGCTACC
BP570 AAAATCATGACGGCCAGTTT
BP571 CTTCCCTTGCTTTTCCCTCT