Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 6 Oligonucleotides used in quantitative reverse transcription PCR (qRT-PCR)

From: Gene expression studies of developing bovine longissimusmuscle from two different beef cattle breeds

Gene Symbol sense sequence Genbank accession number
Myostatin (growth differentiation factor 8) GDF8 FOR1 ACCTTCCCAGAACCAGGAGAA AF019620
   REV TCACAATCAAGCCCAAAATCTCT  
Fatty acid binding protein 4 (adipocyte) FABP4 FOR TGGAAACTTGTCTCCAGTGAAA X89244
   REV ACCCCCATTCAAACTGATGA  
Fatty acid binding protein 5 (psoriasis-associated) FABP5 FOR TGGGAGAGAAGTTTGAAGAGA BT020981
   REV TTCCTGATGTTGAACCAATGC  
Follistatin-like 1 FSTL1 FOR TGCAGACCAGGAGAACAACA BC114758
   REV GGTTGAGGCACTTGAGGAAC  
Insulin-like growth factor binding protein 5 IGFBP5 FOR GGTTTGCCTGAACGAAAAGA S52657
   REV CTTGGGCGAGTAGGTCTCC  
Matrin 3 MATR3 FOR (1) GGAAAAAAGAACCTTCAGACA CB434458
   FOR (2) GACAAAGCTGTGAAAAAAGAT  
   REV CCTCGATCTTGTCCACCTTT  
18S ribosomal RNA 18SrRNA   CGGTCGGCGTCCCCCAACTT AY779625
    GCGTGCAGCCCCGGACATCTAA  
Ribosomal protein large, P0 RPLP0 FOR CAACCCTGAAGTGCTTGACAT NM001012682
   REV GCAAGTGGGAAGGTGTAATCA  
  1. FOR = forward primer; REV = reverse primer