Skip to main content

Table 2 Primer sequences and parameters of standard curves for the selected genes used in the experiment

From: Quantitative evaluation and selection of reference genes in mouse oocytes and embryos cultured in vivo and in vitro

Gene Forward Reverse Slope (m) Intercept (b) R2
Actb ATGAGCTGCCTGACGGCCAGGTCATC
TGGTACCACCAGACAGCACTGTGTTG
-2.97 22.16 0.99
Gapdh TGACGTGCCGCCTGGAGAAA
AGTGTAGCCCAAGATGCCCTTCAG
-3.49 21.69 0.98
Hprt1 GCTTGCTGGTGAAAAGGACCTCTCGAAG
CCCTGAAGTACTCATTATAGTCAAGGGCAT
-3.57 23.02 0.97
H2afz ACAGCGCAGCCATCCTGGAGTA
TTCCCGATCAGCGATTTGTGGA
-3.81 21.20 0.99
Ubc CGTCGAGCCCAGTGTTACCACCAAGAAGG
CCCCCATCACACCCAAGAACAAGCACAAG
-3.67 23.32 0.97
Ppia CGCGTCTCCTTCGAGCTGTTTG
TGTAAAGTCACCACCCTGGCACAT
-3.71 20.84 0.99
Eef1e1 GCGGAGTTGAGGCTGCTGGAGA
AGACTCGGGCCATTGTTTGTCTG
-2.96 26.95 0.96