Skip to main content

Table 1 Primers used for quantitative PCR

From: Conserved and divergent patterns of expression of DAZL, VASA and OCT4 in the germ cells of the human fetal ovary and testis

Gene Sequence Accession No. Product Size
hGAPDF GACATCAAGAAGGTGGTGAAGC   
hGAPDR GTCCACCACCCTGTTGCTGTAG NM_002046 212 bp
hDDX4MVH F AAGAGAGGCGGCTATCGAGATGGA   
hDDX4MVH R CGTTCACTTCCACTGCCACTTCTG NM_024415 238 bp
hOCT4F ACATCAAAGCTCTGCAGAAAGAAC   
hOCT4R CTGAATACCTTCCCAAATAGAACCC NM_002701 126 bp
hDAZLF GAAGGCAAAATCATGCCAAACAC   
hDAZLR CTTCTGCACATCCACGTCATTA NM_ 001351 186 bp