Skip to main content

Table 3 Information on primers used for qPCR

From: Identification of genes differentially expressed during prenatal development of skeletal muscle in two pig breeds differing in muscularity

Gene/EST Source Primer Sequence Ta (°C) Amplicon size (bp)
ACTB 1 AJ312193 GAGAAGCTCTGCTACGTCGC 59 231
   CCTGATGTCCACGTCGCACT   
POLR2A 1 DT324622 GAAGGGGGAGAGACAAACTG 60 86
   GGGAGGAAGAAGAAAAAGGG   
RPL32 1 NM_001001636 AGCCCAAGATCGTCAAAAAG 55 165
   TGTTGCTCCCATAACCAATG   
AGPAT1 1 AL773562 AGGACGCAACGTCGAGAACA 60 110
   GTGAGGGAGGGAAGTGGTGAG   
CANX 1 AJ653783 CAATGATGGATGGGGTCTGAA 60 135
   AACACAGGTAATGCCACAGTCAA   
NME12 EH792596 TGTGGAGAGCGCAGAGAAAGA 58 143
   GGGAGAGAGGAGAAATGGAATGG   
IGSF1 2 EH792632 GAGTCCACCCCATCTACTGTTCC 60 60
   AAATCCCCTTGACCCATCTCA   
HMGA2 2 EH792601 AAGGAGGCAGAAGCAGAATGA 59 74
   TGGAGACCCTCAGAGACAAGAA   
GATA3 3 EH792592 CTTAGGGAAGATGAGTCTGAATGG 59 125
   TTTTGAAGGCAGAAAGCGAAG   
SPP1 3 X16575 TTGCTAAAGCCTGACCCATCT 60 145
   CGTCGTCCACATCGTCTGTT   
SMC6L1 3 EH792668 TGAGGCAGTATCAAGAAGCAAAAG 58 189
   AACAACAGCAACAAAAGAGCCAA   
RAB6IP2 3 EH792612 GGATGTGAAGGAGCGGAAAG 60 121
   AGCCTGCAATGATTTGACTCG   
PDGFRA 3 EH792663 CAGGCAGGTTGGAGGGAGAT 60 101
   AAGTTGCGGAGGTTGGATTCT   
TJP1 3 EH792652 CTGGGCTCTTGGCTTGCTATTC 60 130
   CTCCTCCTGCCGTTTTTGG   
LXN 3 CB477731 CAAGCAAGTGCAAAGAAATGATG 60 151
   TGGCAGACGGCTGTTATGTT   
NRAP 3 EH792618 AAGTGAGGCAGTCTCCAGAGG 60 86
   CATATCCCAGTGAAACACCGAT   
qR15C1 3 Ti784825315 ACAGTGAGAGCGAGCGTGATG 60 158
   TGCTTTCCCTTTATCGGAGG   
bR10D1 3 DQ631863 GCTACACATTCAGCACAGAGTAAGA 60 126
   CTGGGGAAAGACTCCAAAAGA   
  1. 1Reference gene
  2. 2Gene showing stage-associated differential expression as revealed by differential display RT-PCR
  3. 3Gene showing breed-associated differential expression as revealed by differential display RT-PCR