Skip to main content

Table 2 Primers designed for the analysis of WNT4 expression by PCR

From: Differential expression of WNT4 in testicular and ovarian development in a marsupial

Primers Sequence(5'→3') Function
R1 AGCCTGACCATTGGAAGCCCTCT 5'RACE T-PCR
R2 GCCGCACAGAGTCCATCAC 5'RACE
F1 CATCGAGGAGTGCCAGTACCAGTTT 3'RACE
F2 GACGGTGGAACTGCTCGACTCTG 3'RACE T-PCR
SMART IV AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG 5'RACE
CDS III ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30N-1N (N = A, G, C, or T; N-1 = A, G, or C) 3'RACE
5' PCR Primer AAGCAGTGGTATCAACGCAGAGT 5'RACE
qF GAAACCGACGGTGGAAC qPCR
qR AGGAGATGGCATAGACGAA qPCR
18S F GATCCATTGGAGGGCAAGTCT RT-PCR & qPCR
18S R CCAAGATCCAACTACGAGCTTTTT RT-PCR & Qpcr
csF1 GTCATCGGTGGGCAGCATCTC Cross species cloning
csR1 CGTGACACTTGCACTCCACCC Cross species cloning
  1. F, forward primers in the 5' to 3'; R, reverse primers in the 3' to 5' direction. q, quantitative PCR primers for real time analysis; CDS, Smart IV and 5'PCR were synthesized by SIGAMA (Genosys) according to the manual of the SMART cDNA library construction kit from Clontech.