Skip to main content

Table 1 Primers used for real-time PCR

From: Effects of dimethyl sulfoxide on asymmetric division and cytokinesis in mouse oocytes

Genes GenBank accession No. Forward Reverse
Cdc42 NM_021454 ATTATGACAGACTACGACCGCT AGTGGTGAGTTATCTCAGGCA
Fyn NM_008054 ACCTCCATCCCGAACTACAAC CATAAAGCGCCACAAACAGTG
Ran NP_033417 CCACTTGACGGGCGAGTTT CCACACAATACAATGGGGATGTT
Jmy NM_021310 AGCAGGAGATCGACGCTCTAT CCGTCTCGGTGAAAAGAACCT
Ndc80 NM_023294 GCCTCTCTATGCAGGAGTTAAGG CGGTTTGTGTGTACTCAGCTT
Mos NM_020021 CTGTGTCGCTACCTCCCTC ACCGTGGTAAGTGGCTTTATACA
Nuf2 NM_023284 TCCCCAGATACAATGTAGCTGA CCGGACTCCATACACTAACTGT
Wave2 (AY135643 CCGTCAGACGTTGCCTAGC CCGAAAATGTCCTCTGCATACT
Arp2/3 NM_008054 TGAAGCGGACAGGACATTGAT AGTTGGTGATTCCTAGCGTGT