Skip to main content

Advertisement

Table 1 Primer sequences used in molecular cloning and real-time PCR analysis

From: R-spondins are involved in the ovarian differentiation in a teleost, medaka (Oryzias latipes)

Primer Sequence Purpose
Rspo1-F1 TGGGACTGGTGGCGCTGGCGATG fragment amplification
Rspo1-R1 GCCTTTCTTAAACCCACATGT
Rspo2-F1 ATGCAGTTTCGACTCTTCTC
Rspo2-R1 TCACTGGCTGGAGCGAGCAG
Rspo3-F1 GCCATGCAATTACAAGTCATCTC
Rspo3-R1 CTACTGCACAAGGCTGTGCTCGGGG
Rspo1-F2 CCCAGAAGGGAATAACCGATGCACAC 3’- RACE
Rspo1-F3 CACACAGTGGGCGATGCTACGTCAGC
Rspo3-F2 GGCAGACCCTGCCCTTTGACCACAG
Rspo3-F3 GGCAGACCCTGCCCTTTGACCACAG
Rspo1-R2 CGCTCCAAGAAGATAAAGAGCTTGGG 5’- RACE
Rspo1-R2 CTCGTTTCTGCCTTCTCGCCTCCC
Rspo1-F4 AAGTGCGTTGTGCCCAAAACACCG real-time PCR
Rspo1-R4 TCCCATCTTTTCCCTCTCGCCCTAGTC
Rspo2-F2 ACCACCCAAGGACACAATCC
Rspo2-R2 GTGCTTCCCTGAACCACCTC
Rspo3-F4 AAGAGGATCGGGATGAAGCA
Rspo3-R2 TCACACTCCGACCTGCACTT
EF1-α-F CAGCTTCAACGCTCAGGTCAT
EF1-α-R TGAACTTGCAGGCGATGTGA
DMY-F CCGGGTGCCCAA GTGCTCCCGCTG genomic PCR for the genetic sex
DMY-R GATCGTCCCTCCACAGAGAAGAGA