Skip to main content

Table 1 Accession number, primers and probes used for relative quantification of gene expression during gilthead sea bream ontogenic development and dietary vitamin A nutritional imbalance.

From: Coordinated gene expression during gilthead sea bream skeletogenesis and its disruption by nutritional hypervitaminosis A

Gene name Genebank Component 5' to 3' nucleotide sequences
RARA EU643830 Forward CCTGTCTGGACATCCTGATACTTC
   Reverse CGTGAGTCCATCTGAGAAAGTCAT
   FAM probe CTCTGGTGTGTAGCGTGTAC
RARG EU643831 Forward GTGCGTAATGACAGAAACAAGAAGA
   Reverse ACTCCTCTAGCTCTCCACTTAGC
   FAM probe CTTTCTGGAAGCACCACCTC
RXRB AM980430 Forward CCTGAGGCCCATGCAATCTC
   Reverse ACACACATGCGTTTCTGAGACAA
   FAM probe CAGCCCTGGACTAATG
PPARA AY590299 Forward CTTTTCGTGGCTGCCATTATCTG
   Reverse CTCCACCAAAGGCACATCCA
   FAM probe CCTGGGCGATCTCC
PPARB AY590301 Forward GTTTGTTGCTGCCATCATTCTCT
   Reverse CACCTGCTTCACGTTCATTAGC
   FAM probe CCGGGACGATCTCCAC
PPARG AY590304 Forward CAATGTCGGCATGTCACACAAC
   Reverse CTCCTTCTCCGCCTGGG
   FAM probe CCGGCCAAAACGAATG
IGF1 AY996779 Forward GGGCGAGCCCAGAGA
   Reverse GCCGTAGCCAGGTTTACTGAAATAA
   FAM probe TCCACACACAAACTGC
IGF2 AY996778 Forward GTCGGCCACCTCTCTACAG
   Reverse TGCTTCCTTGAGACTTCCTGTTTT
   FAM probe TTACCCGTGATGCCCC
Bmp2 AY500244 Forward GTGGCTTCCATCGTATCAACATTTT
   Reverse GCTCCCCGCCATGAGT
   FAM probe CAGGAGCTCCAAATAA
TGFB1 AF424703 Forward TTTTCCAACTTCGGCTGTACTGT
   Reverse GAGATGCCAAAACTGAAGGTACTGA
   FAM probe ATTGCGGCCGTTCTAG
RBP AY550957 Forward TGGCCACCTTCGAGACAAC
   Reverse GATGCGGCTCCCCAGTAG
   FAM probe CCCCGCCAAGTTCAG
mgp AY065652 Forward CGCCCGAAATACACCTCAGA
   Reverse GACGGACGGATACTAGGAGTCTA
   FAM probe ACCAGCCGCGACTCG
bglap AF048703 Forward CGAGCACATGATGGACACTGA
   Reverse GTCCGTAGTAGGCCGTGTAG
   FAM probe CAGCGATGATTCCC
COL1A1 DQ324363 Forward GGCAACAGTCGCTTCACCTA
   Reverse CCCCATGTACCGGTGTGT
   FAM probe ACGTGCATCCATCCTC
SPP1 AY651247 Forward CCAGCCAGGAGTCAGAGGAT
   Reverse ACTCTCATCTGAGTCGCTGTCA
   FAM probe CTGCTCTGGCTCTCC
SPARC AJ564190 Forward AAGCTGCACCTCGACTACATC
   Reverse CCTTCAGCTCGCTGTCCAT
   FAM probe CAGGGCTCGATCATTT
EF1α AF184170 Forward CCCGGTATGGTTGTCACCTT
   Reverse GGTGCATCTCCACAGACTTGAC
   FAM probe CCCCAGCTGACCACTG
18S   TaqMan® Gene Expression Assay\Eukaryotic 18S rRNA, 20X (Part Number 4331182)
  1. 18S accession number, forward and reverse primers, as well as probe sequences are not shown as the Taqman assay used is proprietary.