Skip to main content

Advertisement

Table 2 Flanking genomic sequences of Tol2 transposon insertions.

From: Optogenetic in vivocell manipulation in KillerRed-expressing zebrafish transgenics

Insertion name Flanking sequence reads from 5' or 3' transposon ends
KR1 Insertion of a concatemer of Tol2 -containing plasmid
KR2* 5:cctACAGCAGGGCCTTCACGTCACCTCTGATACCTCGCACGGTAGACCTCATTCCAGGAAAGACCAAGAGAGCGAACAGCTGCCCTCCTCCTTAAATCCCTAAGCCAAGTGCAGTCATACCTTCATATGCCCCCTTTGGACCAACACATTCAACCTTCCACCCACTCATGAAGGAATGGCGAAAGAGGGGTGAACGGGGATATCATGTAAAAATGCTGGAAGAGAATGATGTTATATCACGAAAATAAAAACGGCTGCAGAGAGGAAGGAAAAAGAAAAATTGGGGGGAAA
  3:aggaaaagAGCATAAACCTGCTTTAGACAGCTGTCGTTCGCCGGATCAGCTACTCAAGAGGCTGTCGTCTATTTGTTGGGCGCTAGATGTGAGCTGATCAATGGGAGACCCCTGCTGGTGTGTTTATGCAACTGCAGTGGCTTTGAAGAACTTAAGTGATCCAATGTACAATGTAGAGTGTGTTGTTGAATGGATGATATATATTTCAGTGCCTTTATTTATCAGGGGTCACCACAGTGGAATGAACCGCTAAATTATCCAGCATAGGTTTTTAC
KR4 5: catggttt TACACAGCTGATGGCCCTTCCAGCTGCAACCCAGTACGGGGGAAACACCTATACACTCATTCACACACACACACACACACACAC
KR11 3a:attaatttTTTCATTCATTTGGTTCAATTTGCCAAAATATTATTAAAATGTTACAAATTGCTTCCAAACACATCTACAACTAGCCTAAAAGGTTGATCACAGGACAAATAAGTCATAAATAGAACATAAGAAGGAGAAAATTATATTTCAATGGTTACCTGCTCTTTTGTCTATGAAGGTATTGTTGTCTCTTTGCTCAACTCACCTCTTTATGTCTTCAAATGACAGGGGTTCATTCACGGTACACTGACAGTCACATATAATCTTAACCAATGCACAGTCTAAGCTGATAGGAGCCATGATCGTTCGTTCATCACGTGACAGAATGACTTAAACCCAAGGACTCGAGAGATGAGTGGTTCAATTCTTTTTCCGGCTCGAAACGCGTATGATTGGCCCGTGATGAACGAGTGACTCAGACCCGATAGAGGACTCTAGAGGTGAGCGGATCAATTCTTTTTCCAGCTCTAAACGCATATGATTGGCTTCTGCCAATGCGATGAAGATTTGAAATTAACGATACTACCTGCACAAATGTGCGC
  3b:gttttgcaGGCAACACTTGCTGAAAGCGGGGATCCGACAGAAGCGGAATTATGACTTGAAAACGAAAGGGCGACACTTCACAGCGGGAGAGAGGGTGTGGGTGTACAGCCCACAGAGGAAGAAGGGCAGGTGCCCTAAACTTGATGCACAGTGGGTGGGGCCTTGCATTGTACTGGAGAGAATTGGGGAAGTTGTTTACCGTGTGCAGATGCCACCAAGAGGCAGGAAAGTAGCGGTGCACAGGGATAGACTGGCTCCGTACAGAGGGTGTGCTTCAGCAGATACAGTGCTGGCCTCTCCTACAGTTATGCCTGTTCTGGAGAATGAGGCGGGACACGGGTTGGGTAGTTCTAATACTATAGATGTCCTCCTTGAAACTACACCAGTTCCTGAGCTACAAAGTTCACATTCTGGTGGCCCTGTTGCAGATAGGGGCTCACCTCGGTCTCAGAGAGTCAAGAGGCCACCAAGACGTCTCCAGGACTATGTTTGTTCCCTCGAGG
KR15 3a:gttggtcaAATATTTGTTAGCTAGCCTATCATTAAAAAGCAAAGTTATTCTGCAATCAGGTTATGTGCTCCATCAGGCACAATCTTAATAGTATCTTGTCGTGTGCTATGCCTAAGTTTTCTTTGTCTTGTAGTGTGTGCACGTTTAAGGTTTGTGTGCACTGTAACCAGATTTCATTTTCGGTTGGGATTTTAAAACTCCTGCAGCAAGTTAGGAGAAAATGAAAGCACATTAAAATGAGGAAAAATCAAATGCTTATGACAATCTTTAACATGACAAATTAAAAATGTAGCAAACAAATGACGGGTTTGTGACCCAATTACAGTGGAGCATTAAAGAAACCCTTATTTCCCACAGAACAAAAAAAATCATCTATTCATGGGCAGGAACAAAAACATACACTTGTATCTTTCTTGTATCTTCATATTATGTGCAATATTTACATTTCTAGAGAAGCCTGTTTTAAACTGTTTTGATTATTACTGACATTTATCATTCATTGCGCTGGTCACTTTAAATGAGCCAGGGCAGGCTTTACAAGCTCTTTGCAGCACTGACCTTGTTCCCAGATCACTTCGGAAGAATGAACTTGGTTGGATGAATGA
  3b:ctaatcagTACCTCTCACTAGGGGGAGTGGGCTAAGTTTTCACATATGACATCATCGCTCTGTCTCCGACGGGTTGCTAATTCTACTACGGTGAGGGTTTGGCTTATGAATATTAAGTACGTAACGATGGTCTTCCTTAGAGGTAGCTGATTGGCTGCAAAGCGAACGTTAGTAAGCGGGATAAGGTGATGCGGTTGATTTCTTGATTAAAGGGACAGTCACATTTTTACATGCATAAACAAAGATGCATGGCTTCAATCCTAAATTTTCGACATTTTCAGATTGAAGTTGACGCTCAGCTCAAATCTTACAACAAAACAACAAAAATGTGTCCGAGTTTTGGTACTATATGAAGAACTGTCGCTGTTGATTCTGATTTGAGTAAGATAGCTTTTCTGTAATGCTCTTAATTTATTTATTTTCATACACTTTTGTTAAATTGTGATTTACTTACCCCCTTCTTTGTTTTGTTAGTCTTTCTCTCTCTG
KR19 5a:gcacctcaCTGTACAGTAGGTGACATGACAATGTAAACAAAGAACTCCGAGATGAGCAGATAAACAAACCGTATCAGTCATTCAAACAAGCCTTATACTAAATGCTTAAATCGTGTTTGCTTTTTGAAAAGAGCCACTTACTTTTTGTCCAGGTAACTTAAGGTGGAAGATGTTACATTCCGTGGCACACAACTGTCCGGTACGAACAAAAACGGTCACCAAAGGCACATACACGCGCCAATGTCCATCTGTTCGTTCTTTCTCAGTTACCAAAGTTTCCAGTCGCCGCAGTTTATACAAAAGTACAGGCTAGCGTTCATAAGCCGGGTACTCTTTGAGAGAAAGAAGCTACGCAAAGCTCAAACAAACTTTCCCATTTCCAATCGCACTGTCATCCTTCACCATATCACGAGGGGAAAAATCCGTTAATATTCCAAAGTCAAACGCGCGCTCCCTCTCTGTACAAGTCCAGTCAAGTGTTTGCAGGTGTCTAGTGTGCTGTGTGCTGTACCTCGCCCTCTCTCCACTACCTCCCTATTAAAACCAGCCAGCCGTGTCAGTGTTAACCAGCTCCCTGCCAGCGCACATGCAACTGCG
  3b:gctgtggcGATCACAGATTAATAAAGGGACTAACCGAAAAGAAAATGAATGAATAACGCTGGATCTAACTTCGTTAACACACAAAAAACAGCTTGTTTTGATTATTGGTTTTGTTTTATTTTGCTTTTTGTCTGTTTTTTTTAGAATTTTATTTAAATTTAGGCAAAAATTTTCCCAGTGATGGGTTGCAGTTGGAAGGCCATCCGCTGCATAAAACATATGCTGGATAAGTTGGCAATTCATTCTGCTGTGGCGACCCCAGATTAATAAAGGGAATAAGCTGGAAAAAAACTAAAGAAAAATTGTTAGCTAAAATAGTCCACCCTGCCATCTAGGACTTTCTGTTTCTGTTTTTTCTTAAAGTTGTAGCATACCGCATGTAATCCATTATATTCAATGCTAATTTTTTTATGCTAAATGTAATTTTGAACAAAGCAATTGCAAACAAAAATGTATCACATTAATCCATGT
  1. To obtain the genomic location of Tol2 insertions, the flanking sequence reads were Blast analyzed against the zebrafish genome sequence database (Zv8) http://www.ensembl.org. In some cases, the flanking sequence reads were Blast analyzed against the unfinished, high-throughput genomic sequence (htgs) database or trace archive at NCBI http://www.ncbi.nlm.nih.gov/projects/genome/seq/BlastGen/BlastGen.cgi?pid=9557. Sequences flanking Tol2 ends (not listed) are highlighted in bold.